This report is based on your raw file genome’s data cross-referencing against available genetic databases and constructing a report based on interpretations in these databases. Variant annotations were made with
OakVar. Annotation databases that was used for report generating: cadd_exome, gnomAD, pubmed, clinpred, clinvar, ncbigene, omim, prec, provean, revel, sift, LongevityMap.
Attention! The information provided is just for informational purposes. Its clinical implementation is possible just after consulting your healthcare practitioner. All drugs, vitamins and lifestyle changes may be prescribed just by your healthcare practitioner, based on clinical blood test results, family history etc. Genetical testing just provides additional information about possible health risk and risk management.
The report consists of:
This report estimates how many significant longevity variations you have and whether its "a lot" or "not so" for your population. The data for this report is obtained mainly by studying centenarians’ genomes.
The longevity variants report is based on 1900 variants from LongevityMap ( genomics.senescence.info/longevity ) and other data sources which are scored and prioritized according to multiple criteria. It also depends on ClinGene, dbSNP and ClinVar modules.
In the table you can see, how many significant for your population variants were found in your genome. Positively longevity-associated variants are marked with green, negatively associated - with red.
We have analyzed genes that affect different longevity pathways in your genome. We have divided them according to the longevity pathways they contribute to. So you can see which of them “work well” and which do not so.
Longevity pathways encompass a fascinating realm of biological processes and signaling pathways that play a crucial role in regulating aging and lifespan. Recent advancements in our understanding of these pathways have yielded valuable insights, including the identification of specific genes that impact the aging process [PMID:33891896].
To help you better understand the role your genes play in longevity, we have categorized them into 11 distinct groups.
Our analysis has allowed us to identify which of your genes contribute to different longevity pathways, giving you a clearer picture of which genes are performing well and which ones may need additional attention.
There is data on Polygenic risk scores (PRSs) for gaining longevity.
PRSs aggregate the effect of many common genetic variants to estimate a person’s chances of gaining extreme longevity. Each variant on its own tends little to the total outcome, but when added together, these differences can have a more significant impact.
PRS results are highly dependent on the population. PPS is calculated as a weighted sum of trait-associated alleles. PRS gives an estimate of how likely an individual is to have a given trait only based on genetics, without taking environmental factors into account.
How to read the result?
PRS is represented as a percentile within a given population. For example, you have the 95th percentile, which means your genetic chances to gain extreme longevity is higher than 95 out of every 100 people in a chosen population.
So percentile ＞50 shows an increased genetic predisposition to longevity, ＜50 - decreased one.
PRS info
This PRS includes an analysis of 332 variants that significantly discriminated between centenarians and older adults.
PRS source: https://doi.org/10.1093/gerona/glaa289
| Title | Longevity PRS (PRS5) | |
| Sum | 6.147905555255802 | |
| Count/total | 114/332 | |
| Average | 0.02696449804936755 | |
| Percentile | 94% |
Lipids play crucial roles in regulating aging and longevity. Lipids are key biological molecules that contribute to cellular and organismal functions in three principal ways. First, they are fundamental structural elements of cellular membranes. Second, they are key molecules in energy metabolism to fuel the cell. Third, they play roles by acting as signaling molecules. Lipid metabolism is not considered a separate longevity pathway, but genes that regulate lipid transfer, like APOE and CETP, show the strongest association with longevity. This is a list of genes we analyzed in your genotype related to lipid transfer:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs429358 | multiple | APOE | C/T | T | C | het | -0.5 | |
| rs4420638 | multiple | APOC1 | G/A | A | G | het | -0.375 | |
| rs405509 | Danish, German, Dutch | APOE | G/G | T | G | hom | -0.3 | |
| rs4784744 | Danish, German, Dutch | CETP | A/G | G | A | het | 0.05 | |
| rs7524519 | American (Caucasian) | LYPLAL1 | G/A | A | G | het | 0.07 | |
| rs9916344 | American (Caucasian) | PITPNM3 | T/C | C | T | het | 0.07 | |
| rs289714 | Danish, German, Dutch | CETP | A/G | G | A | het | 0.15 | |
| rs1800774 | Danish, German, Dutch | CETP | T/C | C | T | het | 0.15 | |
| rs440446 | Danish, German, Dutch | APOE | G/G | C | G | hom | 0.3 |
From 9 gene variants involved in lipid metabolism and longevity pathways, you have 6 favorable and 3 unfavorable.
If your genetic testing reveals that you have unfavorable forms of genes involved in lipid and cholesterol transfer, there are several things you can do to manage your risk and improve your health:
Monitor your health: Regular check-ups and monitoring of your cholesterol levels, blood pressure, and other health parameters can help to identify any issues early and allow for prompt intervention.
Biochemical markers for check-ups: Triglycerides, Total cholesterol level, LDL and HDL cholesterol, and the atherogenicity index (AI). It is a good idea to monitor these markers on a regular basis, at least once per year.
Adopt a healthy lifestyle: it sounds not innovative, but getting regular exercise and maintaining a healthy weight can help to lower your risk of unfavorable lipid metabolism genes.
Take medications if recommended: Your healthcare professional may recommend medications such as statins, which can help to lower your cholesterol levels and reduce your risk of developing cardiovascular disease. Do not take any medicaments if they are not prescribed by a doctor.
Look at pharmacogenetics: If your biochemical lipid profile is disturbed, consider that variations in these genes may be associated with differences in response to statin therapy.
The insulin/insulin-like growth factor (IGF-1) signaling pathway is a key regulator of metabolism, growth, and aging. It has been extensively studied in various model organisms, including worms, flies, and mice, and is also thought to play an important role in human aging and longevity. This pathway is also involved in glucose metabolism. This is a list of genes we analyzed in your genotype related to insulin/IGF-1 signaling pathway:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs2267723 | Danish | GHRHR | G/A | A | G | het | -0.11 | |
| rs5771675 | American (Caucasian) | FAM19A5 | G/A | A | G | het | 0.065 | |
| rs3842755 | Danish | INS | A/C | C | A | het | 0.11 | |
| rs216493 | American (Caucasian) | PLEKHA7 | G/G | A | G | hom | 0.14 | |
| rs155979 | Korean | PCSK1 | C/C | G | C | hom | 0.14 | |
| rs768023 | German | A/G | G | A | het | 0.175 | ||
| rs572169 | Danish | GHSR | T/T | C | T | hom | 0.22 | |
| rs6911407 | German | A/C | C | A | het | 0.25 | ||
| rs4946936 | Chinese (Han) | FOXO3 | C/T | T | C | het | 0.25 | |
| rs2802290 | German | FOXO3 | A/G | G | A | het | 0.3 | |
| rs473268 | German | A/C | C | A | het | 0.35 | ||
| rs479744 | multiple | multiple | T/G | G | T | het | 0.395 | |
| rs9400239 | multiple | FOXO3 | C/T | T | C | het | 0.435 | |
| rs7762395 | multiple | FOXO3 | A/G | G | A | het | 0.445 | |
| rs13217795 | multiple | FOXO3 | T/C | C | T | het | 0.46 |
From 15 gene variants involved in insulin/IGF-1 signaling pathways, you have 14 favorable and 1 unfavorable.
If you have unfavorable variants of insulin/IGF-1 signaling pathway genes, there are several lifestyle changes you can make to help promote healthy aging and reduce the risk of age-related diseases:
Diet: A healthy, balanced diet that is low in sugar and processed foods can help to regulate insulin and IGF-1 levels, which may help to mitigate the effects of unfavorable genes.
Exercise: Regular exercise has been shown to improve insulin sensitivity and promote healthy aging. Aim for at least 30 minutes of moderate-intensity exercise most days of the week, such as brisk walking, cycling, or swimming.
Stress management: Chronic stress can contribute to insulin resistance and age-related diseases. Incorporating stress-management techniques such as meditation, yoga, or deep breathing into your daily routine can help to reduce stress and promote healthy aging.
Sleep: Poor sleep has been linked to insulin resistance and other age-related diseases. Aim for at least 7-8 hours of sleep each night and establish a regular sleep routine to support healthy aging.
Biochemical markers for check-ups: insulin, fasting glucose level, Hemoglobin A1c (HbA1c), and C-peptide. It is a good idea to monitor these markers on a regular basis, at least once per year.
Antioxidant defense plays an important role in the aging process and longevity. Oxidative stress, which is caused by an imbalance between the production of reactive oxygen species (ROS) and the body's ability to neutralize them, is a major contributor to age-related diseases and the aging process.
The body has various mechanisms to defend against oxidative stress, including antioxidant enzymes such as superoxide dismutase (SOD), catalase, and glutathione peroxidase, as well as non-enzymatic antioxidants such as vitamins C and E, and glutathione. These antioxidants work together to neutralize ROS and prevent damage to cells and tissues.
Studies have shown that increased antioxidant defense can promote longevity and delay the onset of age-related diseases. This is a list of genes we analyzed in your genotype related to antioxidant defense:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs7319813 | American (Caucasian) | ENOX1 | T/C | C | T | het | 0.07 | |
| rs4964735 | Danish | TXNRD1 | A/G | G | A | het | 0.105 | |
| rs7301631 | Danish | TXNRD1 | C/T | T | C | het | 0.105 | |
| rs17202060 | Danish | TXNRD1 | T/C | C | T | het | 0.105 | |
| rs7962759 | Danish | TXNRD1 | G/C | C | G | het | 0.105 | |
| rs7318601 | American (Caucasian) | ENOX1 | A/A | G | A | hom | 0.14 | |
| rs10861169 | Danish | TXNRD1 | T/T | C | T | hom | 0.21 | |
| rs4964728 | Danish | TXNRD1 | A/A | G | A | hom | 0.21 | |
| rs7310505 | Danish | TXNRD1 | C/C | A | C | hom | 0.21 | |
| rs10778318 | Danish | TXNRD1 | G/G | A | G | hom | 0.21 |
From 10 gene variants involved in antioxidant defense, you have 10 favorable and 0 unfavorable.
If you have unfavorable variants of antioxidant system genes, there are several lifestyle changes you can make to help promote healthy aging and reduce the risk of age-related diseases:
Ensure the uptake of all components needed for your antioxidant system works appropriately:
Glutathione (which is an important component of your defense) is composed of the amino acids glutamate, cysteine, and glycine. Its’ synthesis requires magnesium, zinc, selenium, and vitamins B2, B6, and B12 as cofactors. Ensure you take all these components from food. NAC supplementation can be used to boost glutathione synthesis.
Flavonoids: They are a group of plant compounds that have antioxidant and anti-inflammatory properties. Good food sources of flavonoids include berries, apples, citrus fruits, and tea.
Selenium: It is a mineral that is important for the production of antioxidant enzymes in the body. Good food sources of selenium include Brazil nuts, seafood, and organ meats.
Polyphenols are a group of naturally occurring compounds found in plant-based foods, including fruits, vegetables, nuts, seeds, and grains. They are known to have antioxidant properties, which means they can help protect the body against damage caused by free radicals.
Polyphenols work by neutralizing free radicals and preventing them from causing oxidative damage to cells and tissues. They can also boost the activity of the body's own antioxidant enzymes, including glutathione peroxidase and superoxide dismutase.Some of the most commonly studied polyphenols include resveratrol, found in grapes and red wine, catechins, found in green tea, and quercetin, found in onions, apples, and berries. Other sources of polyphenols include cocoa, dark chocolate, coffee, and many types of fruits and vegetables.
Biochemical markers for a check-up: oxidized low-density lipoprotein (oxLDL), Fe/Cu ratio, glutathione, 8-hydroxy-2’-deoxyguanosine (8-OHdG) (a marker of oxidative damage to DNA), malondialdehyde (MDA) (it is a byproduct of lipid peroxidation and is used as a marker of oxidative stress). It is a good idea to monitor these markers on a regular basis, at least once per year.
Mitochondria are the powerhouses of the cell, generating the energy (in the form of ATP) needed for cellular processes. They also play a key role in apoptosis (programmed cell death) and other cellular processes. Mitochondrial dysfunction and increased oxidative stress are believed to play a role in the aging process and age-related diseases. Several genes involved in mitochondrial function have been implicated in longevity. They include UCP genes, genes involved in respiratory chain functioning, SIRT3, PGC1a, and some other genes.
In general, the form of these genes determines how well you are protected from oxidative stress and how effectively your cells generate energy. This is a list of genes we analyzed in your genotype related to mitochondria function:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs6435326 | Danish | NDUFS1 | T/T | A | T | hom | -0.19 | |
| rs9557276 | American (Caucasian) | CLYBL | T/T | G | T | hom | 0.14 | |
| rs3019435 | American (Caucasian) | PRKN | T/T | G | T | hom | 0.14 | |
| rs1042718 | Chinese | ADRB2 | A/A | C | A | hom | 0.195 | |
| rs1042719 | Chinese | ADRB2 | C/C | G | C | hom | 0.195 | |
| rs15763 | Italian (Southern) | UCP3 | G/A | A | G | het | 0.245 | |
| rs6435324 | Danish | NDUFS1 | G/G | A | G | hom | 0.38 |
From 7 gene variants involved in mitochondrial function, you have 6 favorable and 1 unfavorable.
If you have unfavorable variants in genes involved in mitochondrial function, there are several steps you can take to improve your health outcomes potentially:
Biochemical markers for check-ups: lactate, pyruvate, and creatine kinase, markers of oxidative stress, such as glutathione level and Fe/Cu ratio.
Consider adequate uptake of trace elements and vitamins essential for mitochondria function: magnesium, B vitamins (particularly thiamine (B1), riboflavin (B2), and niacin (B3)), selenium, iron, copper, and vitamin E.
Exercise: Regular exercise has been shown to increase mitochondrial biogenesis (the process of creating new mitochondria) and improve mitochondrial function. This is thought to be due to increased energy demand during exercise, which triggers the body to produce more mitochondria.
The sirtuin genes (SIRT1-SIRT7) are a family of genes that are involved in regulating cellular processes such as DNA repair, metabolism, and stress response. The sirtuin pathway, which involves the activity of these genes, has been implicated in regulating longevity.
Studies have shown that activation of sirtuins can increase lifespan in several model organisms, including yeast, worms, and mice. This is thought to be due to the role of sirtuins in promoting cellular resilience and protecting cells from damage.
In humans, variations in the SIRT genes have been associated with age-related diseases such as Alzheimer's disease, cardiovascular disease, and cancer. Some studies have also suggested that increased activity of SIRT genes may be associated with increased lifespan and improved healthspan in humans.
This is a list of genes we analyzed in your genotype related to sirtuin pathway:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs107251 | Danish, German, Dutch | SIRT6 | C/T | T | C | het | 0.15 |
From 1 gene variants involved in the sirtuin pathway, you have 1 favorable and 0 unfavorable.
There are several ways to activate the sirtuin pathway if your genes are not favorable:
Exercise: Exercise has been shown to increase sirtuin activity in multiple tissues, including skeletal muscle, liver, and brain. Both endurance and resistance exercise may be effective in activating the sirtuin pathway.
Supplementation: Supplementation with compounds such as resveratrol and nicotinamide riboside has been shown to increase sirtuin activity in multiple tissues. These compounds are thought to work by mimicking the effects of caloric restriction on sirtuin activity. Consider that in human trials effect of these compounds has not yet been shown. So before taking any supplements, consult your healthcare practitioner.
Intermittent fasting: Intermittent fasting is a dietary strategy that involves cycling between periods of fasting and non-fasting. Intermittent fasting has been shown to increase sirtuin activity in multiple tissues and may activate the sirtuin pathway.
MTOR, also known as the mechanistic target of rapamycin, is a gene that encodes for a protein kinase involved in multiple cellular processes, including growth, metabolism, and aging. The mTOR pathway plays a complex role in aging and longevity. On the one hand, activation of the mTOR pathway has been shown to promote cellular growth and proliferation, which may be beneficial for tissue repair and regeneration during early life stages. On the other hand, chronic activation of the mTOR pathway has been implicated in age-related diseases such as cancer, metabolic disorders, and neurodegeneration.
Studies have shown that genetic or pharmacological inhibition of the mTOR pathway can extend the lifespan in a variety of model organisms, including mice, flies, and worms. Additionally, modulation of the mTOR pathway has been shown to improve age-related functional decline and delay the onset of age-related diseases in various animal models.
Genetic variants in the MTOR gene may be associated with differences in lifespan and age-related disease risk.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs1016339 | American (Caucasian) | CCDC85A | T/C | C | T | het | 0.07 | |
| rs4729049 | American (Caucasian) | CDK6 | C/T | T | C | het | 0.07 | |
| rs10937739 | American (Caucasian) | PPP2R2C | C/T | T | C | het | 0.08 |
From 3 gene variants involved in mTOR pathway, you have 3 favorable and 0 unfavorable.
There are several ways to influence mTOR pathway if your genes are not favorable:
Fasting: Intermittent fasting or periodic fasting has been shown to decrease mTOR activity.
Use spices: Curcumin is a compound found in turmeric, which has been shown to inhibit mTOR activity.
Plant-based diet: A diet rich in fruits, vegetables, whole grains, and legumes has been associated with decreased mTOR activity.
Tumor suppressor genes and cell cycle regulators are not typically considered as "longevity genes" per se, but they do play an important role in the aging process and the development of age-related diseases, including cancer.
One well-known tumor suppressor gene is TP53, which has been shown to play a role in regulating cellular senescence and preventing the accumulation of damaged cells. Similarly, cell cycle regulators such as cyclin-dependent kinases (CDKs) are involved in regulating the timing and progression of cell division. The dysregulation of CDKs has been implicated in a variety of age-related diseases, including cancer and neurodegenerative disorders.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs4977756 | American (Caucasian) | CDKN2B-AS1 | A/G | G | A | het | -0.18 | |
| rs1063192 | American (Caucasian) | CDKN2B | A/G | G | A | het | 0.18 | |
| rs1412832 | American (Caucasian) | CDKN2B-AS1 | T/C | C | T | het | 0.18 | |
| rs3120819 | American (Caucasian) | TP53 | C/A | A | C | het | 0.24 | |
| rs13008689 | American (Caucasian) | TP53 | A/G | G | A | het | 0.24 | |
| rs9616906 | American (Caucasian) | TP53 | A/G | G | A | het | 0.24 | |
| rs10819510 | American (Caucasian) | TP53 | G/A | A | G | het | 0.24 | |
| rs189037 | multiple | ATM | A/G | G | A | het | 0.33 |
From 8 gene variants of tumor-suppressive genes, you have 7 favorable and 1 unfavorable regarding their impact on longevity*.
If you have unfavorable variants in genes involved in genome maintenance, there are several steps you can take to improve your health outcomes potentially:
Ensure methylation processes in your body work well: monitor blood levels of B12, B9, B2, B6, Zn, and Co[PMID: 31601260, PMID: 36203899]. These components are needed for methylation enzymes' appropriate work. Methylation is important for genome maintenance because it is involved in the regulation of gene expression and DNA repair [PMID: 34209979].
Reduce exposure to environmental toxins, such as pollution, pesticides, and chemicals. Air-control indoor systems can help with this point.
Protect the skin from UV radiation by wearing protective clothing and using sunscreen.
Avoid tobacco: Tobacco use is a leading cause of cancer, so avoiding tobacco in all forms, including smoking, vaping, and chewing, can significantly decrease the risk of cancer.
*In our analysis, we have categorized tumor-suppressive gene variants based solely on their effect on longevity as either favorable or unfavorable. We would like to clarify that our report does not provide an assessment of whether these variants have an increased risk for cancer or not.
The renin-angiotensin system (RAS) plays an important role in the regulation of blood pressure, fluid balance, and electrolyte homeostasis. However, it is also involved in the aging process and the development of age-related diseases.
One of the mechanisms by which RAS influences aging is through the activation of oxidative stress and inflammation. RAS also affects the cardiovascular system and is involved in the development of hypertension, a major risk factor for cardiovascular diseases such as heart attack and stroke. Furthermore, RAS activation has been linked to the development of insulin resistance and metabolic syndrome, which are also associated with aging and age-related diseases.
In addition, RAS has been implicated in the regulation of cellular senescence, a process by which cells lose their ability to divide and contribute to aging and age-related diseases.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs1879417 | Italian (Southern) | NOS1 | T/C | C | T | het | -0.12 | |
| rs422858 | Italian (Northern) and Japanese | AGTR1 | C/C | A | C | hom | 0.225 | |
| rs275653 | Italian (Northern) and Japanese | AGTR1 | G/G | A | G | hom | 0.45 |
From 3 gene variants of genes related to the renin-angiotensin system, you have 2 favorable and 1 unfavorable regarding their impact on longevity.
There are several ways to activate the sirtuin pathway if your genes are not favorable:
Control your blood pressure level
Look at pharmacogenetics: you may have a low response to angiotensin-converting enzyme (ACE) inhibitors, depending on the variants carrying, so talk to your healthcare practitioner.
Diet: A healthy diet can help prevent hypertension and improve overall cardiovascular health. Here are some dietary tips to follow: limit processed and high-fat foods, as well as sugary drinks and snacks; reduce your salt intake by using herbs and spices to flavor your food instead of salt, and avoid high-sodium packaged and processed foods; incorporate calcium-rich foods such as low-fat dairy products, tofu, and leafy greens into your diet.
The HSP (heat shock protein) genes are a group of genes that encode heat shock proteins, which are a class of chaperone proteins that help to protect cells from stress-induced damage. HSPs have been shown to play a role in a variety of cellular processes, including protein folding, DNA repair, and apoptosis. While the exact mechanisms by which HSPA genes influence aging and longevity are not yet fully understood, it is believed that they may help to protect cells from the accumulation of damage caused by stress and other environmental factors. As such, HSPs and their associated genes may be a promising target for interventions aimed at promoting healthy aging and extending lifespan. Some unfavorable variants in HSP genes have been shown to reduce the ability of cells to respond to stress, leading to increased damage and inflammation.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight |
|---|
From 0 gene variants related to heat-shock proteins, you have 0 favorable and 0 unfavorable.
If you have unfavorable heat shock protein (HSP) gene variants, there are several things you can do to reduce cell stress:
Environmental factors: Avoiding exposure to environmental toxins, such as cigarette smoke, pollution, and pesticides, can help reduce cellular stress and inflammation.
Sleep: Getting adequate sleep is important for reducing cellular stress and promoting cellular repair and regeneration.
Chronic inflammation is a major contributor to the aging process. Inflammation is a natural response of the immune system to harmful stimuli, such as pathogens or tissue damage. However, if this response becomes chronic, it can lead to tissue damage and the development of age-related diseases such as Alzheimer's disease, cardiovascular disease, and cancer.
Chronic inflammation is characterized by the sustained activation of the immune system and the release of pro-inflammatory molecules, such as cytokines, chemokines, and reactive oxygen species (ROS). These molecules can damage cellular components, including DNA, proteins, and lipids, leading to cellular dysfunction and death.
In addition, chronic inflammation can also activate other pathways involved in aging, such as the mTOR pathway and the senescence-associated secretory phenotype (SASP), which further exacerbate inflammation and tissue damage. Therefore, reducing chronic inflammation is a promising strategy to promote healthy aging and prevent age-related diseases.
Chronic inflammation can have a genetic component, with certain genes being associated with increased inflammation levels.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs590211 | American (Caucasian) | PKNOX2 | G/A | A | G | het | 0.07 | |
| rs2232548 | American (Caucasian) | KLRF1 | T/G | G | T | het | 0.07 | |
| rs205499 | American (Caucasian) | TRIM25 | A/G | G | A | het | 0.07 | |
| rs6997589 | American (Caucasian) | SH2D4A | A/G | G | A | het | 0.07 | |
| rs4648884 | American (Caucasian) | RUNX3 | C/T | T | C | het | 0.08 | |
| rs9517320 | American (Caucasian) | STK24 | C/A | A | C | het | 0.08 | |
| rs2251252 | Italian (Southern) | SDC4 | A/G | G | A | het | 0.09 | |
| rs1981429 | Italian (Southern) | SDC4 | T/G | G | T | het | 0.09 | |
| rs1450741 | Korean | LYN | C/T | T | C | het | 0.09 | |
| rs2072454 | Korean | EGFR | T/C | C | T | het | 0.1 | |
| rs3804474 | American (Caucasian) | LY86 | T/T | C | T | hom | 0.14 | |
| rs1546518 | Korean | LYN | C/C | G | C | hom | 0.18 | |
| rs5744256 | Italian | IL18 | G/G | A | G | hom | 0.2 |
From 13 gene variants related to inflammation, you have 13 favorable and 0 unfavorable.
If you have unfavorable variants in genes involved in chronic inflammation, there are several steps you can take to improve your health outcomes potentially:
Biochemical markers for check-ups: C-reactive protein (CRP), ferritin, tumor necrosis factor-alpha (TNF-alpha).
Diet: Consuming a balanced diet that is rich in anti-inflammatory foods such as fruits, vegetables, whole grains, and fatty fish can help reduce inflammation. Some herbs and spices have an antiinflammatory action so that they can be added to the diet: garlic, ginger, turmeric, cinnamon, and oregano.
Dentist check-ups: regular dental check-ups and good oral hygiene practices can help prevent chronic inflammation in the gums and other oral tissues. Periodontal disease, which is caused by bacteria and leads to inflammation and tissue destruction in the gums, is a common cause of chronic inflammation.
Air cleaning: air pollutants are a common source of chronic inflammation. Control your air quality indoors, and use filter systems if needed.
Genome maintenance and post-transcriptional processes are both important for maintaining cellular and organismal homeostasis, and both have been implicated in the regulation of longevity.
Genome maintenance is essential for preventing DNA damage and mutations that can lead to age-related diseases and shortened lifespans. Post-transcriptional processes, including RNA splicing, translation, and decay, are important for regulating gene expression and ensuring that proteins are produced at the appropriate levels and times. Dysregulation of these processes can lead to age-related diseases and shortened lifespans.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs2805533 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | A/A | G | A | hom | -0.35 | |
| rs2485662 | American (Caucasians), Italian (Southern), French, Ashkenazi Jewish | LMNA | C/C | T | C | hom | -0.27 | |
| rs414743 | Italian, Ashkenazi Jewish and Japanese | ADARB1 | A/G | G | A | het | -0.175 | |
| rs701176 | American (Caucasian) | PCNX2 | A/G | G | A | het | 0.07 | |
| rs6732163 | American (Caucasian) | BABAM2 | G/A | A | G | het | 0.07 | |
| rs6443429 | American (Caucasian) | TBL1XR1 | C/A | A | C | het | 0.07 | |
| rs1800392 | American (Caucasian) | WRN | T/G | G | T | het | 0.078 | |
| rs2838816 | Italian, Ashkenazi Jewish and Japanese | ADARB1 | A/G | G | A | het | 0.175 | |
| rs3024239 | American (Caucasian) | WRN | T/C | C | T | het | 0.195 |
From 9 gene variants related to genome maintenance and post-transcriptional processes, you have 6 favorable and 3 unfavorable.
If you have unfavorable variants in genes involved in genome maintenance, there are several steps you can take to improve your health outcomes potentially:
Ensure methylation processes in your body work well: monitor blood levels of B12, B9, B2, B6, Zn, and Co[PMID: 31601260, PMID: 36203899]. These components are needed for methylation enzymes' appropriate work. Methylation is important for genome maintenance because it is involved in the regulation of gene expression and DNA repair [PMID: 34209979].
Reduce exposure to environmental toxins, such as pollution, pesticides, and chemicals. Air-control indoor systems can help with this point.
Check vitamin D level: Vitamin D plays a role in DNA repair and has been shown to have a protective effect regarding genome maintenance [PMID: 11295155].
Protect the skin from UV radiation by wearing protective clothing and using sunscreen.
Although genes associated with longevity can be classified into 11 definite pathways, there are other genes that do not fall into these categories, which are presented in this table.
Although many genes associated with longevity can be classified into 11 definite pathways, there are other genes that do not fall into these categories, which are presented in this table.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs3847663 | American | A/G | G | A | het | 0.025 | ||
| rs1733676 | American | A/A | G | A | hom | 0.05 | ||
| rs2024714 | American (Caucasian) | CDH4 | T/C | C | T | het | 0.065 | |
| rs2826891 | American (Caucasian) | NCAM2 | T/C | C | T | het | 0.065 | |
| rs2032563 | American (Caucasian) | CAMTA1 | A/G | G | A | het | 0.07 | |
| rs10489436 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs11211037 | American (Caucasian) | BTBD19 | C/A | A | C | het | 0.07 | |
| rs10923673 | American (Caucasian) | G/T | T | G | het | 0.07 | ||
| rs12043001 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs4285687 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs6657655 | American (Caucasian) | LOC105373215 | T/C | C | T | het | 0.07 | |
| rs2247549 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4237774 | American (Caucasian) | LOC107984303 | A/G | G | A | het | 0.07 | |
| rs1834461 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs563384 | American (Caucasian) | TENM4 | G/A | A | G | het | 0.07 | |
| rs1470196 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs11063009 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs855137 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs2660888 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs697887 | American (Caucasian) | LINC02463 | G/A | A | G | het | 0.07 | |
| rs1340573 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs9652250 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs9513192 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs7149754 | American (Caucasian) | LOC105370656 | G/A | A | G | het | 0.07 | |
| rs10518725 | American (Caucasian) | WDR72 | A/G | G | A | het | 0.07 | |
| rs1280396 | American (Caucasian) | CGNL1 | G/A | A | G | het | 0.07 | |
| rs12446827 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs1005321 | American (Caucasian) | HS3ST3B1 | A/G | G | A | het | 0.07 | |
| rs2880540 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs8073559 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs9894254 | American (Caucasian) | SGSH | T/C | C | T | het | 0.07 | |
| rs12606250 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs2927261 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs7246865 | American (Caucasian) | MYO9B | A/G | G | A | het | 0.07 | |
| rs11687681 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs401974 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs3769583 | American (Caucasian) | TTC27 | T/C | C | T | het | 0.07 | |
| rs2901840 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs12623542 | American (Caucasian) | LINC01237 | G/T | T | G | het | 0.07 | |
| rs2866705 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs2253363 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs5754682 | American (Caucasian) | LARGE1 | T/C | C | T | het | 0.07 | |
| rs12634249 | American (Caucasian) | SUMF1 | A/C | C | A | het | 0.07 | |
| rs751481 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs922943 | American (Caucasian) | RARB | A/G | G | A | het | 0.07 | |
| rs1550765 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs10084768 | American (Caucasian) | LINC01182 | A/G | G | A | het | 0.07 | |
| rs828154 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs358256 | American (Caucasian) | GBA3 | C/T | T | C | het | 0.07 | |
| rs2660342 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs1230155 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs2553377 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs4461634 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs2432143 | American (Caucasian) | ITGA1 | C/T | T | C | het | 0.07 | |
| rs158807 | American (Caucasian) | G/T | T | G | het | 0.07 | ||
| rs147295 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs9324976 | American (Caucasian) | C/A | A | C | het | 0.07 | ||
| rs514217 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4245543 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs11153598 | American (Caucasian) | NT5DC1 | A/C | C | A | het | 0.07 | |
| rs1858897 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs2738173 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs804283 | American (Caucasian) | GATA4 | A/G | G | A | het | 0.07 | |
| rs899430 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4871976 | American (Caucasian) | PHYHIP | A/G | G | A | het | 0.07 | |
| rs7825208 | American (Caucasian) | FGFR1 | G/A | A | G | het | 0.07 | |
| rs1812736 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs12353067 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs2590504 | American (Caucasian) | PPP1R26-AS1 | T/C | C | T | het | 0.08 | |
| rs10149689 | Ashkenazi Jewish | CEP128 | G/A | A | G | het | 0.085 | |
| rs12050077 | Ashkenazi Jewish | CEP128 | A/G | G | A | het | 0.085 | |
| rs2498804 | Dutch | LOC107987209 | A/C | C | A | het | 0.095 | |
| rs1468772 | American (Caucasians), Italian (Southern), French, Ashkenazi Jewish | SEMA4A | G/G | T | G | hom | 0.1 | |
| rs205990 | American (Amish) | LOC105378102 | G/G | A | G | hom | 0.1 | |
| rs73598374 | Italian (Central) | ADA | T/C | C | T | het | 0.115 | |
| rs7799039 | Jordanian | LOC105375494 | A/G | G | A | het | 0.115 | |
| rs12129750 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs12737127 | American (Caucasian) | LOC105373220 | C/C | A | C | hom | 0.14 | |
| rs4933309 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs11218921 | American (Caucasian) | LOC341056 | C/C | T | C | hom | 0.14 | |
| rs2722222 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs2014547 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs2543356 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs7155817 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs2277509 | American (Caucasian) | CCDC88C | A/A | C | A | hom | 0.14 | |
| rs8098316 | American (Caucasian) | G/G | T | G | hom | 0.14 | ||
| rs9304496 | American (Caucasian) | KCTD1 | T/T | C | T | hom | 0.14 | |
| rs11086106 | American (Caucasian) | PGPEP1 | T/T | C | T | hom | 0.14 | |
| rs1974676 | American (Caucasian) | HPCAL1 | G/G | A | G | hom | 0.14 | |
| rs4363980 | American (Caucasian) | LOC105373714 | G/G | T | G | hom | 0.14 | |
| rs1463990 | American (Caucasian) | LOC107985988 | A/A | G | A | hom | 0.14 | |
| rs6115865 | American (Caucasian) | C20orf194 | T/T | C | T | hom | 0.14 | |
| rs3904864 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs2201186 | American (Caucasian) | LOC107986178 | A/A | G | A | hom | 0.14 | |
| rs4073968 | American (Caucasian) | LINC01258 | T/T | C | T | hom | 0.14 | |
| rs975072 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs1490813 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs6580511 | American (Caucasian) | A/A | G | A | hom | 0.14 | ||
| rs303006 | American (Caucasian) | CMAHP | G/G | A | G | hom | 0.14 | |
| rs6946852 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs6991271 | American (Caucasian) | KIF13B | G/G | T | G | hom | 0.14 | |
| rs567971 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs829751 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs1016013 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs4541274 | American (Caucasian) | CTNNA2 | C/T | T | C | het | 0.205 | |
| rs723525 | American (Caucasian) | CTNNA2 | G/A | A | G | het | 0.205 | |
| rs7656234 | American (Caucasian) | SLC4A4 | T/T | C | T | hom | 0.37 | |
| rs1860242 | American (Caucasian) | CTNND2 | G/G | A | G | hom | 0.41 |
Plenty of drugs are frequently prescribed at an older age. Moreover, some drugs are known to have geroprotective action (e.g. statins, metformin, rapamycin, etc.). Drug metabolism to a large extent depends on a person’s genetic polymorphisms, affecting the activity of xenobiotics-transforming enzymes. So it’s a common situation when individual dose correction is needed, or even another drug has to be taken in order to avoid adverse effects. Longevity-drugs report is mainly based on data from PharmGKB database ( https://www.pharmgkb.org/ ) and DrugAge.
In the table you can find data about your genome’s gene variants, associated with a changed response to the drugs.
| # | Variant/Haplotypes | Drug(s) | Phenotype Category | Significance | Sentence | Allele Of Frequency In Cases | Allele Of Frequency In Controls | Ratio Stat Type | Effect |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs2284018 | lithium | Efficacy | yes | Genotype TT is associated with decreased response to lithium in people with Bipolar Disorder as compared to genotypes CC + CT. | OR | 9.091 | ||
| 2 | rs7316769 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 7.692 | ||
| 3 | rs10771999 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 7.692 | ||
| 4 | rs5441 | sertraline | Efficacy | yes | Genotype GG is associated with increased response to sertraline in people with Depressive Disorder, Major as compared to genotypes AA + AG. | G | OR | 5.9 | |
| 5 | rs7306991 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 5.882 | ||
| 6 | rs10771997 | duloxetine | Efficacy | yes | Allele T is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 5.882 | ||
| 7 | rs10771998 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 5.882 | ||
| 8 | rs12595802 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 5.556 | ||
| 9 | rs12630569 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 5.556 | ||
| 10 | rs4513095 | sofosbuvir | Efficacy | yes | Allele A is associated with decreased response to sofosbuvir in people with Hepatitis C, Chronic as compared to allele C. | A | A | OR | 5.54 |
| 11 | rs7563206 | methotrexate | Efficacy | yes | Genotypes CT + TT is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype CC. | C | C | OR | 5.0 |
| 12 | rs7787082 | clozapine | Efficacy | yes | Allele G is associated with decreased response to clozapine in people with Schizophrenia as compared to allele A. | A | OR | 4.87 | |
| 13 | rs3087403 | cisplatin | Efficacy | yes | Genotypes CT + TT are associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype CC. | T | OR | 4.44 | |
| 14 | rs1056827 | risperidone | Efficacy | no | Allele A is associated with decreased response to risperidone in people with Schizophrenia as compared to allele C. | A | A | OR | 4.37 |
| 15 | rs243865 | ulinastatin | Efficacy | yes | Allele T is associated with decreased response to ulinastatin in people with Pancreatitis as compared to allele C. | T | T | OR | 4.121 |
| 16 | rs622342 | metformin | Efficacy | yes | Genotypes AC + CC is associated with decreased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype AA. | A | OR | 4.1 | |
| 17 | rs11591741 | ustekinumab | Efficacy | yes | Genotypes CC + CG is associated with increased response to ustekinumab in people with Psoriasis as compared to genotype GG. | OR | 33.333 | ||
| 18 | rs1801133 | fluorouracil | Efficacy | yes | Genotypes AA + AG is associated with increased response to fluorouracil in people with Colorectal Neoplasms as compared to genotype GG. | A | OR | 3.8 | |
| 19 | rs4437856 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.704 | ||
| 20 | rs2419128 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.704 | ||
| 21 | rs12094644 | duloxetine | Efficacy | yes | Allele T is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 3.704 | ||
| 22 | rs1883112 | idarubicin | Efficacy | yes | Genotype AA is associated with increased response to idarubicin in people with Leukemia, Myeloid, Acute as compared to genotype GG. | A | OR | 3.7 | |
| 23 | rs4633 | risperidone | Efficacy | no | Allele T is associated with decreased response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 3.56 |
| 24 | rs10007051 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.448 | ||
| 25 | rs11933890 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 3.333 | ||
| 26 | rs62319299 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.333 | ||
| 27 | rs56229625 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.333 | ||
| 28 | rs55881666 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.333 | ||
| 29 | rs4639250 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.333 | ||
| 30 | rs12657120 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.226 | ||
| 31 | rs10012 | risperidone | Efficacy | no | Allele C is associated with decreased response to risperidone in people with Schizophrenia as compared to allele G. | C | C | OR | 3.16 |
| 32 | rs2270007 | citalopram | Efficacy | yes | Genotypes CC + CG are associated with decreased response to citalopram in people with Depressive Disorder, Major as compared to genotype GG. | C | C | OR | 2.93 |
| 33 | rs8636 | amisulpride | Efficacy | yes | Genotype CT is associated with increased response to amisulpride in people with Schizophrenia as compared to genotypes CC + TT. | C | C | OR | 2.91 |
| 34 | rs6498169 | glatiramer acetate | Efficacy | yes | Allele A is associated with increased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.86 |
| 35 | rs2284017 | lithium | Efficacy | not stated | Allele C is associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | OR | 2.857 | ||
| 36 | rs316019 | metformin | Efficacy | yes | Genotypes AA + AC is associated with increased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype CC. | A | A | OR | 2.857 |
| 37 | rs1695 | cyclophosphamide | Efficacy | no | Genotypes AG + GG is associated with decreased response to cyclophosphamide in people with Lupus Nephritis as compared to genotype AA. | G | G | OR | 2.8 |
| 38 | rs3749442 | cannabidiol | Efficacy | yes | Genotypes AA + AG are associated with decreased response to cannabidiol in people with Epilepsy as compared to genotype GG. | OR | 2.778 | ||
| 39 | rs2114358 | glatiramer acetate | Efficacy | yes | Allele A is associated with increased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.77 |
| 40 | rs11869731 | lithium | Efficacy | yes | Genotype CC is associated with increased response to lithium in people with Bipolar Disorder as compared to genotypes CG + GG. | C | C | OR | 2.39 |
| 41 | rs4818 | risperidone | Efficacy | no | Allele G is associated with increased response to risperidone in people with Schizophrenia as compared to allele C. | C | C | OR | 2.381 |
| 42 | rs3747178 | ethosuximide | Efficacy | yes | Allele T is associated with decreased clinical benefit to ethosuximide in children with Epilepsy as compared to allele C. | T | T | OR | 2.38 |
| 43 | rs1800469 | glatiramer acetate | Efficacy | yes | Allele A is associated with decreased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.326 |
| 44 | rs165599 | bupropion | Efficacy | yes | Genotypes AA + AG are associated with increased response to bupropion in smokers as compared to genotype GG. | A | OR | 2.21 | |
| 45 | rs1801058 | metoprolol | Efficacy | yes | Genotype CT is associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype CC. | HR | 2.174 | ||
| 46 | rs2631372 | imatinib | Efficacy | yes | Genotypes CG + GG are associated with increased response to imatinib in people with Gastrointestinal Stromal Tumors as compared to genotype CC. | HR | 2.174 | ||
| 47 | rs680244 | Drugs used in nicotine dependence | Other | yes | Allele T is associated with increased response to Drugs used in nicotine dependence in people with Tobacco Use Disorder. | HR | 2.083 | ||
| 48 | rs616147 | creatine | Efficacy | yes | Genotypes AA + AG are associated with increased response to creatine in people with Amyotrophic Lateral Sclerosis as compared to genotype GG. | A | HR | 2.083 | |
| 49 | rs1495741 | iguratimod | Efficacy | yes | Genotypes AG + GG is associated with decreased clinical benefit to iguratimod in people with Arthritis, Rheumatoid as compared to genotype AA. | G | G | OR | 2.008 |
| 50 | rs1012335 | glatiramer acetate | Efficacy | yes | Allele G is associated with decreased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele C. | G | G | OR | 13.889 |
| 51 | rs11042725 | paroxetine | Efficacy | yes | Genotype CC is associated with decreased response to paroxetine in people with Depressive Disorder, Major as compared to genotypes AA + AC. | OR | 13.333 | ||
| 52 | rs9923231 | acenocoumarol | Dosage | yes | Genotype TT is associated with decreased dose of acenocoumarol as compared to genotypes CC + CT. | T | OR | 11.6 | |
| 53 | rs1329428 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.961 | ||
| 54 | rs3763980 | methotrexate | Efficacy | yes | Allele A is associated with decreased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to allele T. | OR | 1.887 | ||
| 55 | rs10033900 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.887 | ||
| 56 | rs3781719 | botulinum toxin type a | Efficacy | yes | Allele G is associated with decreased response to botulinum toxin type a in women with Migraine NOS as compared to allele A. | G | G | OR | 1.88 |
| 57 | rs2631370 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele T. | C | OR | 1.87 | |
| 58 | rs2010963 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | C | OR | 1.852 | |
| 59 | rs2804402 | methotrexate | Toxicity | no | Allele A is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | G | HR | 1.79 | |
| 60 | rs1800544 | methylphenidate | Efficacy | no | Allele G is associated with decreased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 1.786 | ||
| 61 | rs6990851 | anastrozole | Efficacy | yes | Allele G is associated with increased response to anastrozole in women with Breast Neoplasms as compared to allele A. | HR | 1.786 | ||
| 62 | rs8109525 | bupropion | Efficacy | yes | Genotype GG is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes AA + AG. | G | OR | 1.78 | |
| 63 | rs1410996 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 1.754 | ||
| 64 | rs2032582 | imatinib | Efficacy | no | Allele T is not associated with response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to allele A. | G | A | OR | 1.754 |
| 65 | rs2032582 | imatinib | Efficacy | no | Allele T is not associated with response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to allele A. | G | A | OR | 1.754 |
| 66 | rs7574865 | adalimumab | Efficacy | no | Allele T is not associated with response to adalimumab in people with Arthritis, Rheumatoid as compared to allele G. | T | OR | 1.724 | |
| 67 | rs628031 | imatinib | Efficacy | yes | Genotypes AA + AG is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype GG. | OR | 1.724 | ||
| 68 | rs2229437 | benazepril | Efficacy | yes | Genotypes GG + GT are associated with decreased response to benazepril in people with Hypertension as compared to genotype TT. | T | OR | 1.667 | |
| 69 | rs10737680 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele C. | OR | 1.613 | ||
| 70 | rs12231740 | methotrexate | Efficacy | yes | Allele T is associated with decreased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to allele C. | OR | 1.587 | ||
| 71 | rs20455 | pravastatin | Efficacy | yes | Genotypes AG + GG are associated with increased response to pravastatin in people with Myocardial Infarction as compared to genotype AA. | HR | 1.587 | ||
| 72 | rs2236259 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | T | OR | 1.587 | |
| 73 | rs3204953 | cisplatin | Efficacy | no | Genotypes CT + TT are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype CC. | T | OR | 1.56 | |
| 74 | rs3212986 | cisplatin | Efficacy | yes | Allele A is associated with decreased response to cisplatin in women with Ovarian Neoplasms as compared to allele C. | A | OR | 1.53 | |
| 75 | rs249429 | metformin | Efficacy | no | Allele T is not associated with response to metformin in people with Diabetes Mellitus as compared to allele C. | C | T | OR | 1.471 |
| 76 | rs3852209 | nicotine | Efficacy | yes | Genotypes CT + TT are associated with increased response to nicotine in people with Tobacco Use Disorder as compared to genotype CC. | T | OR | 1.46 | |
| 77 | rs7905446 | nortriptyline | Efficacy | no | Genotype TT is not associated with response to nortriptyline in people with Depression as compared to genotypes GG + GT. | OR | 1.441 | ||
| 78 | rs2494732 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 1.414 |
| 79 | rs274717 | gemcitabine | Efficacy | no | Genotypes AG + GG are associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotype AA. | HR | 1.408 | ||
| 80 | rs2960306 | metoprolol | Efficacy | no | Genotype TT is not associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype GG. | HR | 1.389 | ||
| 81 | rs2811332 | lithium | Efficacy | no | Allele C is not associated with response to lithium in people with Bipolar Disorder as compared to allele G. | C | C | OR | 1.36 |
| 82 | rs2236256 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele A. | A | OR | 1.35 | |
| 83 | rs3736544 | lithium | Efficacy | no | Allele A is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele G. | A | OR | 1.333 | |
| 84 | rs2082940 | pioglitazone | Efficacy | no | Genotype CC are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotypes CT + TT. | C | T | OR | 1.303 |
| 85 | rs16969968 | nicotine | Other | no | Allele A is not associated with exposure to nicotine in men as compared to allele G. | A | OR | 1.3 | |
| 86 | rs2306283 | atorvastatin | Efficacy | yes | Genotype AA is associated with increased response to atorvastatin in people with Hypercholesterolemia as compared to genotypes AG + GG. | G | OR | 1.29 | |
| 87 | rs8065082 | metformin | Efficacy | yes | Genotypes CT + TT is associated with increased response to metformin in people with Glucose Intolerance as compared to genotype CC. | HR | 1.282 | ||
| 88 | rs1800797 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele A. | RR | 1.282 | ||
| 89 | rs1800796 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele C. | RR | 1.282 | ||
| 90 | rs1800795 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele C. | RR | 1.282 | ||
| 91 | rs6313 | risperidone | Efficacy | no | Allele A is not associated with response to risperidone in people with Schizophrenia as compared to allele G. | A | A | OR | 1.274 |
| 92 | rs699947 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele A. | C | OR | 1.27 | |
| 93 | rs868755 | imatinib | Dosage | no | Allele T is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | T | OR | 1.266 | |
| 94 | rs1063538 | pioglitazone | Efficacy | no | Genotypes CC + CT are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype TT. | C | T | OR | 1.255 |
| 95 | rs1800532 | venlafaxine | Efficacy | no | Allele G is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele T. | OR | 1.25 | ||
| 96 | rs12205732 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | A | OR | 1.242 | |
| 97 | rs762551 | imatinib | Dosage | yes | Genotype CC is associated with decreased dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to genotypes AA + AC. | C | OR | 1.235 | |
| 98 | rs2295553 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 1.235 | ||
| 99 | rs2740574 | amlodipine | Efficacy | no | Genotypes CT + TT are not associated with response to amlodipine in people with Hypertension as compared to genotype CC. | HR | 1.235 | ||
| 100 | rs6280 | clozapine | Efficacy | not stated | Allele T is not associated with response to clozapine in people with Schizophrenia as compared to allele C. | OR | 1.22 | ||
| 101 | rs17035723 | acamprosate | Efficacy | no | Allele T is not associated with response to acamprosate in people with Alcoholism as compared to allele C. | HR | 1.22 | ||
| 102 | rs266729 | pioglitazone | Efficacy | no | Genotype CC are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotypes CG + GG. | G | C | OR | 1.219 |
| 103 | rs3774261 | pioglitazone | Efficacy | no | Genotypes AG + GG are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype AA. | G | A | OR | 1.209 |
| 104 | rs1329424 | ranibizumab | Efficacy | no | Allele G is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.205 | ||
| 105 | rs2278749 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 1.18 | |
| 106 | rs11212617 | metformin | Efficacy | no | Allele C is not associated with response to metformin in people with Diabetes Mellitus, Type 2 as compared to allele A. | OR | 1.163 | ||
| 107 | rs9828223 | adalimumab | Efficacy | yes | Allele T is associated with decreased response to adalimumab in people with Crohn Disease as compared to allele C. | T | OR | 1.16 | |
| 108 | rs2231142 | sulfasalazine | Other | no | Allele T is not associated with discontinuation of sulfasalazine in people with Arthritis, Rheumatoid as compared to allele G. | T | HR | 1.15 | |
| 109 | rs1042522 | oxaliplatin | Efficacy | yes | Genotypes CG + GG is associated with decreased response to oxaliplatin in people with Colorectal Neoplasms as compared to genotype CC. | G | HR | 1.136 | |
| 110 | rs683369 | imatinib | Dosage | no | Allele G is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele C. | G | OR | 1.136 | |
| 111 | rs3821799 | pioglitazone | Efficacy | no | Genotypes CT + TT are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype CC. | C | T | OR | 1.131 |
| 112 | rs2244500 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | OR | 1.124 | ||
| 113 | rs6506569 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 1.124 | ||
| 114 | rs293983 | belimumab | Efficacy | no | Allele T is not associated with response to belimumab in people with Lupus erythematosus as compared to allele C. | OR | 1.111 | ||
| 115 | rs1390913 | lithium | Efficacy | no | Allele A is not associated with response to lithium in people with Bipolar Disorder as compared to allele G. | A | A | OR | 1.11 |
| 116 | rs6495307 | nicotine | Other | no | Allele T is not associated with exposure to nicotine in men as compared to allele C. | T | OR | 1.1 | |
| 117 | rs6347 | methadone | Dosage | no | Allele C is not associated with dose of methadone in people with Heroin Dependence as compared to allele T. | C | OR | 1.09 | |
| 118 | rs2013169 | methylphenidate | Efficacy | no | Allele T is associated with decreased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 1.087 | ||
| 119 | rs662 | clopidogrel | Efficacy | no | Genotypes CC + CT is not associated with response to clopidogrel in people with Acute coronary syndrome as compared to genotype TT. | T | HR | 1.087 | |
| 120 | rs3808627 | heroin | Dosage | no | Allele T is not associated with dose of heroin in people with Heroin Dependence as compared to allele C. | T | OR | 1.082 | |
| 121 | rs1947274 | methylphenidate | Efficacy | no | Allele A is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 1.053 | ||
| 122 | rs6902403 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | T | OR | 1.053 | |
| 123 | rs3212964 | cisplatin | Efficacy | no | Allele T is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele C. | T | OR | 1.05 | |
| 124 | rs4483927 | risperidone | Efficacy | no | Allele G is not associated with response to risperidone in people with Schizophrenia as compared to allele T. | G | G | OR | 1.033 |
| 125 | rs2071559 | imatinib | Dosage | no | Allele A is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | A | OR | 1.02 | |
| 126 | rs3393 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | C | HR | 1.01 | |
| 127 | rs11568817 | venlafaxine | Efficacy | no | Allele C is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele A. | OR | 1.01 | ||
| 128 | rs2230199 | eculizumab | Efficacy | no | Genotypes CC + CG is not associated with response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype GG. | C | OR | 1.0 | |
| 129 | rs5836788 | methotrexate | Efficacy | no | Allele del is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 1.0 | ||
| 130 | rs3827020 | nicotine | Other | no | Allele C is not associated with exposure to nicotine in men as compared to allele T. | C | OR | 1.0 | |
| 131 | rs2072660 | varenicline | Efficacy | no | Genotypes CT + TT are not associated with response to varenicline in people with Tobacco Use Disorder as compared to genotype CC. | OR | 0.99 | ||
| 132 | rs1051740 | carbamazepine | Efficacy | no | Genotype TT is not associated with resistance to carbamazepine in people with Epilepsy as compared to genotypes CC + CT. | C | T | OR | 0.98 |
| 133 | rs1024323 | metoprolol | Efficacy | no | Genotype CC is not associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype TT. | HR | 0.98 | ||
| 134 | rs1805054 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 0.973 |
| 135 | rs699517 | methotrexate | Efficacy | no | Allele T is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.971 | ||
| 136 | rs9567746 | venlafaxine | Efficacy | no | Allele A is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.962 | ||
| 137 | rs3212961 | cisplatin | Efficacy | no | Allele A is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele G. | A | OR | 0.962 | |
| 138 | rs743572 | abiraterone | Efficacy | no | Genotypes AG + GG are not associated with response to abiraterone in men with Prostatic Neoplasms as compared to genotype AA. | G | HR | 0.96 | |
| 139 | rs6912029 | heroin | Dosage | no | Allele T is not associated with dose of heroin in people with Heroin Dependence as compared to allele G. | T | OR | 0.955 | |
| 140 | rs3394 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | T | HR | 0.952 | |
| 141 | rs2234922 | carbamazepine | Efficacy | no | Genotype AA is not associated with resistance to carbamazepine in people with Epilepsy as compared to genotypes AG + GG. | A | G | OR | 0.952 |
| 142 | rs6296 | venlafaxine | Efficacy | no | Allele C is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.952 | ||
| 143 | rs6935207 | imatinib | Dosage | no | Allele A is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | A | OR | 0.94 | |
| 144 | rs6551665 | methylphenidate | Efficacy | no | Allele A is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele G. | OR | 0.935 | ||
| 145 | rs1049305 | cisplatin | Efficacy | no | Genotypes CC + CG are not associated with response to cisplatin in people with Mesothelioma as compared to genotype GG. | HR | 0.926 | ||
| 146 | rs228666 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.92 | |
| 147 | rs2236257 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele G. | C | OR | 0.92 | |
| 148 | rs615470 | nicotine | Other | no | Allele T is not associated with exposure to nicotine in men as compared to allele C. | T | OR | 0.909 | |
| 149 | rs228642 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.901 | |
| 150 | rs2279287 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 0.901 | |
| 151 | rs2631367 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | G | OR | 0.9 | |
| 152 | rs12666409 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele T. | A | OR | 0.896 | |
| 153 | rs5320 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | A | OR | 0.895 | |
| 154 | rs130058 | venlafaxine | Efficacy | no | Allele A is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.893 | ||
| 155 | rs4810083 | metformin | Efficacy | no | Allele T is not associated with response to metformin in people with Diabetes Mellitus as compared to allele C. | C | T | OR | 0.89 |
| 156 | rs1136287 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.885 | ||
| 157 | rs4343 | sertraline | Efficacy | no | Genotype GG is not associated with response to sertraline in people with Depressive Disorder. | G | G | OR | 0.885 |
| 158 | rs2640909 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.88 | |
| 159 | rs228729 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 0.877 | |
| 160 | rs1045280 | nicotine | Efficacy | no | Allele C is not associated with response to nicotine in people with Tobacco Use Disorder as compared to allele T. | C | OR | 0.877 | |
| 161 | rs2236196 | varenicline | Efficacy | no | Genotypes AA + AG is not associated with response to varenicline in people with Tobacco Use Disorder as compared to genotype GG. | OR | 0.87 | ||
| 162 | rs9322453 | heroin | Dosage | no | Allele C is not associated with dose of heroin in people with Heroin Dependence as compared to allele G. | C | OR | 0.865 | |
| 163 | rs129915 | methadone | Dosage | no | Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele A. | G | OR | 0.861 | |
| 164 | rs27072 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele C. | T | OR | 0.858 | |
| 165 | rs6064463 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 0.855 | ||
| 166 | rs735482 | cisplatin | Efficacy | no | Allele C is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele A. | C | OR | 0.85 | |
| 167 | rs10011796 | allopurinol | Efficacy | no | Genotypes CT + TT are not associated with response to allopurinol in people with Gout as compared to genotype CC. | C | T | OR | 0.85 |
| 168 | rs12529 | abiraterone | Efficacy | no | Genotypes CC + CG are not associated with response to abiraterone in men with Prostatic Neoplasms as compared to genotype GG. | C | HR | 0.847 | |
| 169 | rs1800497 | risperidone | Efficacy | no | Allele A is not associated with response to risperidone in people with Schizophrenia as compared to allele G. | A | A | OR | 0.845 |
| 170 | rs4982133 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.84 | ||
| 171 | rs316009 | metformin | Efficacy | yes | Genotype TT is associated with increased response to metformin in people with Diabetes Mellitus as compared to genotypes CC + CT. | OR | 0.826 | ||
| 172 | rs1176713 | risperidone | Efficacy | no | Allele G is not associated with response to risperidone in people with Schizophrenia as compared to allele A. | G | G | OR | 0.819 |
| 173 | rs3842727 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | G | OR | 0.807 | |
| 174 | rs12979860 | peginterferon alfa-2b | Efficacy | no | Genotype CC is not associated with increased response to peginterferon alfa-2b in people with Hepatitis B, Chronic as compared to genotype CT. | OR | 0.806 | ||
| 175 | rs12693402 | lithium | Efficacy | no | Allele C is not associated with response to lithium in people with Bipolar Disorder as compared to allele T. | C | C | OR | 0.8 |
| 176 | rs4680 | levodopa | Dosage | no | Genotype AA is not associated with dose of levodopa in people with Parkinson Disease as compared to genotype GG. | A | OR | 0.8 | |
| 177 | rs699946 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.8 | ||
| 178 | rs800292 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.794 | ||
| 179 | rs5888 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.781 | ||
| 180 | rs2650972 | methotrexate | Efficacy | no | Allele T is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.781 | ||
| 181 | rs10770140 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele C. | C | OR | 0.766 | |
| 182 | rs2160734 | acamprosate | Efficacy | no | Allele C is not associated with response to acamprosate in people with Alcoholism as compared to allele T. | C | C | HR | 0.763 |
| 183 | rs3761372 | methylphenidate | Efficacy | no | Allele T is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.763 | ||
| 184 | rs3787429 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 0.756 |
| 185 | rs34897046 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele G. | OR | 0.746 | ||
| 186 | rs162040 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.741 | ||
| 187 | rs10770141 | methadone | Dosage | no | Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele A. | A | OR | 0.73 | |
| 188 | rs3792452 | methylphenidate | Efficacy | not stated | Genotype CT is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype CC. | OR | 0.714 | ||
| 189 | rs929740 | methylphenidate | Efficacy | no | Allele G is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.714 | ||
| 190 | rs2236258 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | C | OR | 0.714 | |
| 191 | rs6973474 | buprenorphine | Efficacy | yes | Allele T is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.712 | ||
| 192 | rs4291 | sertraline | Efficacy | no | Genotype TT is not associated with response to sertraline in people with Depressive Disorder. | T | T | OR | 0.709 |
| 193 | rs3745274 | efavirenz | Efficacy | yes | Genotypes GT + TT are associated with decreased resistance to efavirenz in people with HIV Infections as compared to genotype GG. | T | T | OR | 0.7 |
| 194 | rs13169373 | buprenorphine | Efficacy | yes | Allele T is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.696 | ||
| 195 | rs12943590 | metformin | Efficacy | yes | Genotypes AA + AG is associated with increased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype GG. | A | A | OR | 0.68 |
| 196 | rs274713 | gemcitabine | Efficacy | yes | Genotype GG is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes GT + TT. | HR | 0.671 | ||
| 197 | rs465646 | cisplatin | Efficacy | no | Genotypes AG + GG are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype AA. | G | OR | 0.667 | |
| 198 | rs1799836 | levodopa | Dosage | no | Genotype TT is not associated with dose of levodopa in women with Parkinson Disease as compared to genotype CC. | T | OR | 0.667 | |
| 199 | rs9032 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.658 | ||
| 200 | rs28362731 | cisplatin | Efficacy | no | Genotype AG is not associated with response to cisplatin in people with Mesothelioma as compared to genotype GG. | HR | 0.641 | ||
| 201 | rs1061170 | photodynamic therapy | Efficacy | no | Genotype TT is not associated with response to photodynamic therapy in people with Macular Degeneration as compared to genotype CC. | C | OR | 0.637 | |
| 202 | rs4627790 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.629 | ||
| 203 | rs35661809 | salbutamol | Efficacy | yes | Allele G is associated with increased response to salbutamol in children with as compared to allele A. | OR | 0.629 | ||
| 204 | rs3803300 | risperidone | Efficacy | no | Allele C is not associated with response to risperidone in people with Schizophrenia as compared to allele T. | C | C | OR | 0.628 |
| 205 | rs610604 | ustekinumab | Efficacy | no | Genotype GG is not associated with response to ustekinumab in people with Psoriasis as compared to genotype TT. | G | OR | 0.625 | |
| 206 | rs12248560 | clopidogrel | Efficacy | no | Genotypes CT + TT is not associated with response to clopidogrel in people with Coronary Artery Disease as compared to genotype CC. | T | OR | 0.62 | |
| 207 | rs11559290 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.617 | ||
| 208 | rs3212980 | cisplatin | Efficacy | no | Genotype GT is associated with increased response to cisplatin in women with Ovarian Neoplasms as compared to genotype TT. | G | OR | 0.61 | |
| 209 | rs73598374 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | T | HR | 0.61 | |
| 210 | rs4562 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.606 | ||
| 211 | rs2799018 | methylphenidate | Efficacy | no | Allele T is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.599 | ||
| 212 | rs2242446 | venlafaxine | Efficacy | yes | Genotype CC is associated with increased response to venlafaxine in people with Depressive Disorder, Major as compared to genotypes CT + TT. | C | OR | 0.599 | |
| 213 | rs17834628 | salbutamol | Efficacy | yes | Allele A is associated with increased response to salbutamol in children with as compared to allele G. | OR | 0.599 | ||
| 214 | rs678849 | buprenorphine | Efficacy | yes | Genotype CC is associated with decreased response to buprenorphine in people with Opioid-Related Disorders as compared to genotypes CT + TT. | RR | 0.592 | ||
| 215 | rs11280056 | fluorouracil | Efficacy | yes | Genotype TTAAAGTTA/del is associated with decreased response to fluorouracil in people with Colorectal Neoplasms as compared to genotype del/del. | HR | 0.592 | ||
| 216 | rs4358872 | methadone | Dosage | no | Genotype GG is associated with decreased dose of methadone in people with Heroin Dependence as compared to genotypes GT + TT. | OR | 0.59 | ||
| 217 | rs1045642 | sunitinib | Efficacy | yes | Genotype AA is associated with decreased response to sunitinib in people with Carcinoma, Renal Cell as compared to genotypes AG + GG. | A | HR | 0.588 | |
| 218 | rs1801274 | cetuximab | Efficacy | yes | Genotype GG is associated with increased response to cetuximab in people with Head and Neck Neoplasms as compared to genotypes AA + AG. | A | HR | 0.585 | |
| 219 | rs581111 | buprenorphine | Efficacy | yes | Genotypes AA + AG is associated with decreased response to buprenorphine in women with Opioid-Related Disorders as compared to genotype GG. | RR | 0.581 | ||
| 220 | rs4805162 | methylphenidate | Efficacy | no | Allele G is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.581 | ||
| 221 | rs5569 | methylphenidate | Efficacy | yes | Genotype GG is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes AA + AG. | OR | 0.578 | ||
| 222 | rs7118900 | methadone | Dosage | no | Genotypes AA + AG are associated with decreased dose of methadone in people with Heroin Dependence as compared to genotype GG. | OR | 0.57 | ||
| 223 | rs2336219 | cisplatin | Efficacy | no | Genotypes AG + GG are associated with increased response to cisplatin in women with Ovarian Neoplasms as compared to genotype AA. | A | OR | 0.56 | |
| 224 | rs529520 | buprenorphine | Efficacy | yes | Genotype AA is associated with decreased response to buprenorphine in women with Opioid-Related Disorders as compared to genotype CC. | RR | 0.556 | ||
| 225 | rs13120400 | methotrexate | Efficacy | yes | Genotype CC is associated with increased response to methotrexate in people with Psoriasis as compared to genotypes CT + TT. | OR | 0.556 | ||
| 226 | rs3810818 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.552 | ||
| 227 | rs675026 | methadone | Efficacy | no | Allele G is not associated with response to methadone in people with Heroin Dependence as compared to allele A. | A | OR | 0.552 | |
| 228 | rs7719775 | platinum | Efficacy | no | Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype GG. | OR | 0.549 | ||
| 229 | rs756770 | buprenorphine | Efficacy | yes | Allele A is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.538 | ||
| 230 | rs1044457 | gemcitabine | Efficacy | yes | Genotype CC is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes CT + TT. | HR | 0.526 | ||
| 231 | rs429358 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.526 | ||
| 232 | rs2153628 | indomethacin | Efficacy | yes | Allele G is associated with increased response to indomethacin as compared to allele A. | OR | 0.521 | ||
| 233 | rs2279343 | bupropion | Efficacy | yes | Genotype AA is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes AG + GG. | A | G | OR | 0.521 |
| 234 | rs6269 | quetiapine | Efficacy | yes | Allele A is associated with decreased response to quetiapine in people with Schizophrenia as compared to allele G. | OR | 0.516 | ||
| 235 | rs35687416 | gemcitabine | Efficacy | yes | Genotype GG is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes GT + TT. | HR | 0.515 | ||
| 236 | rs3087386 | cisplatin | Efficacy | no | Genotypes AA + AG are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype GG. | A | OR | 0.51 | |
| 237 | rs1128503 | sunitinib | Efficacy | no | Genotype AA is not associated with response to sunitinib in people with Carcinoma, Renal Cell as compared to genotypes AG + GG. | G | A | OR | 0.5 |
| 238 | rs1048786 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.493 | ||
| 239 | rs6878291 | platinum | Efficacy | yes | Genotype GG is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype AA. | G | G | OR | 0.49 |
| 240 | rs776746 | sunitinib | Dosage | yes | Allele T is associated with decreased dose of sunitinib in people with Carcinoma, Renal Cell as compared to allele C. | OR | 0.49 | ||
| 241 | rs7624046 | ritodrine | Efficacy | yes | Genotype TT is associated with decreased response to ritodrine as compared to genotypes CC + CT. | HR | 0.485 | ||
| 242 | rs2053044 | ramipril | Efficacy | yes | Genotypes AA + AG is associated with increased response to ramipril in people with Hypertension as compared to genotype GG. | HR | 0.478 | ||
| 243 | rs10835210 | methadone | Dosage | no | Genotype CC is associated with increased dose of methadone in people with Heroin Dependence as compared to genotypes AA + AC. | OR | 0.467 | ||
| 244 | rs12409352 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.465 | ||
| 245 | rs3210967 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.465 | ||
| 246 | rs10465180 | clozapine | Efficacy | yes | Genotype CC is associated with decreased response to clozapine in people with Schizophrenia as compared to genotypes CT + TT. | OR | 0.465 | ||
| 247 | rs4149117 | imatinib | Efficacy | yes | Genotypes GG + GT is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype TT. | OR | 0.461 | ||
| 248 | rs7311358 | imatinib | Efficacy | yes | Genotypes AA + AG is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype GG. | OR | 0.461 | ||
| 249 | rs1801394 | methotrexate | Efficacy | yes | Genotypes AG + GG is associated with increased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to genotype AA. | OR | 0.457 | ||
| 250 | rs1051266 | methotrexate | Efficacy | yes | Genotypes CT + TT is associated with increased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype CC. | T | OR | 0.455 | |
| 251 | rs523349 | abiraterone | Efficacy | yes | Genotype CC is associated with increased response to abiraterone in men with Prostatic Neoplasms as compared to genotypes CG + GG. | C | HR | 0.43 | |
| 252 | rs2838958 | methotrexate | Efficacy | yes | Genotype AA is associated with decreased response to methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes AG + GG. | HR | 0.427 | ||
| 253 | rs6545816 | hydroxyurea | Efficacy | no | Allele A is not associated with increased response to hydroxyurea in people with beta-Thalassemia. | A | A | OR | 0.417 |
| 254 | rs1799983 | salvianolic acid b | Efficacy | yes | Genotype GG is associated with increased response to salvianolic acid b in people with Coronary Disease as compared to genotypes GT + TT. | T | OR | 0.408 | |
| 255 | rs4938013 | clozapine | Efficacy | no | Allele C is not associated with response to clozapine in people with Schizophrenia as compared to allele A. | A | OR | 0.402 | |
| 256 | rs12610827 | olanzapine | Efficacy | yes | Allele T is associated with increased clinical benefit to olanzapine in people with Schizophrenia as compared to allele G. | OR | 0.402 | ||
| 257 | rs1800470 | rituximab | Efficacy | yes | Genotype AG is associated with increased response to rituximab in people with Arthritis, Rheumatoid as compared to genotype AA. | OR | 0.385 | ||
| 258 | rs462779 | cisplatin | Efficacy | yes | Genotypes AG + GG are associated with decreased response to cisplatin in people with Osteosarcoma as compared to genotype AA. | G | OR | 0.385 | |
| 259 | rs2233945 | etanercept | Efficacy | yes | Allele C is associated with decreased response to etanercept in people with Arthritis, Rheumatoid as compared to allele A. | A | OR | 0.37 | |
| 260 | rs7703002 | platinum | Efficacy | no | Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype CC. | OR | 0.366 | ||
| 261 | rs2853539 | methotrexate | Efficacy | yes | Genotype AA is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | OR | 0.362 | ||
| 262 | rs3077 | peginterferon alfa-2b | Efficacy | yes | Genotype GG is associated with increased response to peginterferon alfa-2b in people with Hepatitis B, Chronic as compared to genotypes AA + AG. | OR | 0.36 | ||
| 263 | rs1731017 | valproic acid | Efficacy | no | Genotypes AA + AG is associated with increased resistance to valproic acid in people with Epilepsy as compared to genotype GG. | A | A | OR | 0.358 |
| 264 | rs11615 | cisplatin | Efficacy | yes | Allele A is associated with decreased response to cisplatin in women with Ovarian Neoplasms as compared to allele G. | A | OR | 0.348 | |
| 265 | rs3212227 | methotrexate | Other | no | Allele G is not associated with response to methotrexate in people with Psoriasis as compared to allele T. | OR | 0.347 | ||
| 266 | rs6785930 | clopidogrel | Efficacy | yes | Genotypes AA + AG is associated with increased resistance to clopidogrel as compared to genotype GG. | OR | 0.346 | ||
| 267 | rs324026 | olanzapine | Efficacy | yes | Allele C is associated with increased clinical benefit to olanzapine in people with Schizophrenia as compared to allele T. | C | C | OR | 0.345 |
| 268 | rs28386840 | methylphenidate | Efficacy | yes | Genotypes AT + TT are associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype AA. | OR | 0.341 | ||
| 269 | rs1232027 | methotrexate | Efficacy | yes | Allele A is associated with increased response to methotrexate in people with Arthritis, Psoriatic as compared to allele G. | OR | 0.334 | ||
| 270 | rs12708954 | atomoxetine | Efficacy | yes | Allele A is associated with increased response to atomoxetine in children with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 0.323 | ||
| 271 | rs1643650 | methotrexate | Efficacy | no | Genotypes CC + CT is associated with increased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype TT. | C | C | OR | 0.31 |
| 272 | rs833061 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.291 | ||
| 273 | rs7079 | benazepril | Efficacy | yes | Genotype GG is associated with response to benazepril in women with Hypertension as compared to genotype TT. | OR | 0.286 | ||
| 274 | rs4646 | tamoxifen | Efficacy | yes | Genotype AA is associated with decreased response to tamoxifen in women with Breast Neoplasms and Menopause as compared to genotypes AC + CC. | A | HR | 0.277 | |
| 275 | rs6809699 | clopidogrel | Efficacy | yes | Genotypes AA + AC is associated with increased resistance to clopidogrel as compared to genotype CC. | OR | 0.272 | ||
| 276 | rs11269124 | clonidine | Efficacy | yes | Genotypes GGGGAGCTTTCCCAGAGACCC/del + del/del are associated with increased response to clonidine in people with Liver Cirrhosis as compared to genotype GGGGAGCTTTCCCAGAGACCC/GGGGAGCTTTCCCAGAGACCC. | OR | 0.258 | ||
| 277 | rs12539 | cannabidiol | Efficacy | yes | Genotypes CT + TT are associated with increased response to cannabidiol in people with Epilepsy as compared to genotype CC. | OR | 0.253 | ||
| 278 | rs10248420 | clozapine | Efficacy | yes | Allele A is associated with decreased response to clozapine in people with Schizophrenia as compared to allele G. | A | OR | 0.244 | |
| 279 | rs25487 | fluorouracil | Efficacy | yes | Genotype CC is associated with increased response to fluorouracil in people with Rectal Neoplasms as compared to genotype CT. | OR | 0.239 | ||
| 280 | rs10124893 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.239 | ||
| 281 | rs3784864 | methotrexate | Efficacy | yes | Genotypes AG + GG are associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype AA. | OR | 0.236 | ||
| 282 | rs2070762 | methylphenidate | Efficacy | yes | Genotype GG is associated with decreased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes AA + AG. | OR | 0.231 | ||
| 283 | rs12083537 | tocilizumab | Efficacy | yes | Genotype AA is associated with increased response to tocilizumab in people with Arthritis, Rheumatoid as compared to genotypes AG + GG. | G | OR | 0.23 | |
| 284 | rs12502866 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.229 | ||
| 285 | rs3811381 | eculizumab | Efficacy | no | Genotypes CG + GG is not associated with response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype CC. | C | OR | 0.227 | |
| 286 | rs10123866 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 287 | rs7472 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 288 | rs7035619 | duloxetine | Efficacy | yes | Allele A is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.227 | ||
| 289 | rs6479008 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 290 | rs10989064 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.227 | ||
| 291 | rs9873889 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.216 | ||
| 292 | rs9879065 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.216 | ||
| 293 | rs3213422 | leflunomide | Efficacy | yes | Genotype CC is associated with increased clinical benefit to leflunomide in people with Arthritis, Rheumatoid as compared to genotypes AA + AC. | A | OR | 0.212 | |
| 294 | rs1799732 | bupropion | Efficacy | yes | Genotype GG is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes G/del + del/del. | OR | 0.2 | ||
| 295 | rs2853542 | methotrexate | Efficacy | yes | Genotype GG is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CC + CG. | G | G | OR | 0.185 |
| 296 | rs1427407 | hydroxyurea | Efficacy | yes | Allele T is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele G. | T | T | OR | 0.164 |
| 297 | rs150929 | imatinib | Efficacy | yes | Genotypes GG + GT is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype TT. | OR | 0.157 | ||
| 298 | rs2276302 | clozapine | Efficacy | yes | Allele G is associated with increased response to clozapine in people with Schizophrenia as compared to allele A. | G | OR | 0.152 | |
| 299 | rs9332238 | warfarin | Dosage | yes | Allele G is associated with increased dose of warfarin as compared to allele A. | OR | 0.147 | ||
| 300 | rs2274567 | eculizumab | Efficacy | yes | Genotypes AG + GG is associated with decreased response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype AA. | A | OR | 0.138 | |
| 301 | rs9310657 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.115 | ||
| 302 | rs9310658 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.115 | ||
| 303 | rs7616119 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.115 | ||
| 304 | rs7653345 | duloxetine | Efficacy | yes | Allele A is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.115 | ||
| 305 | rs9819548 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.115 | ||
| 306 | rs13093500 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.115 | ||
| 307 | rs9824595 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.115 | ||
| 308 | rs4334661 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.115 | ||
| 309 | rs766432 | hydroxyurea | Efficacy | yes | Allele C is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele A. | C | C | OR | 0.11 |
| 310 | rs10210302 | adalimumab | Efficacy | yes | Genotypes CT + TT is associated with increased response to adalimumab in people with Crohn Disease as compared to genotype CC. | C | OR | 0.106 | |
| 311 | rs144854329 | cetuximab | Efficacy | yes | Genotype del/del is associated with increased response to cetuximab in people with Colorectal Neoplasms as compared to genotypes GGTCCCACTCTTCCCACA/GGTCCCACTCTTCCCACA + GGTCCCACTCTTCCCACA/del. | GGTCCCACTCTTCCCACA | GGTCCCACTCTTCCCACA | OR | 0.1 |
| 312 | rs1799724 | etanercept | Efficacy | yes | Genotypes CT + TT is associated with increased response to etanercept in people with Arthritis, Rheumatoid as compared to genotype CC. | OR | 0.083 | ||
| 313 | rs5882 | rosuvastatin | Efficacy | yes | Allele G is associated with increased response to rosuvastatin as compared to allele A. | G | OR | 0.075 | |
| 314 | rs2284411 | methylphenidate | Efficacy | yes | Genotype CC is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes CT + TT. | C | OR | 0.07 | |
| 315 | rs9934438 | warfarin | Dosage | yes | Genotype AG is associated with increased dose of warfarin in people with Atrial Fibrillation, Cardiomyopathies, heart valve replacement, Peripheral Vascular Diseases, Pulmonary Embolism and Venous Thrombosis as compared to genotype GG. | A | OR | 0.06 | |
| 316 | rs6311 | ustekinumab | Efficacy | yes | Genotypes CT + TT is associated with decreased response to ustekinumab in people with Psoriasis as compared to genotype CC. | OR | 0.05 | ||
| 317 | rs1570360 | sildenafil | Efficacy | yes | Genotype AA is associated with decreased response to sildenafil in men with Erectile Dysfunction as compared to genotypes AG + GG. | A | A | OR | 0.05 |
| 318 | rs1967554 | methadone | Efficacy | yes | Allele C is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele A. | OR | 0.049 | ||
| 319 | rs988748 | methadone | Efficacy | yes | Allele C is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele G. | OR | 0.049 | ||
| 320 | rs2030324 | methadone | Efficacy | yes | Allele G is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele A. | OR | 0.049 | ||
| 321 | rs749671 | warfarin | Dosage | yes | Allele G is associated with increased dose of warfarin as compared to allele A. | OR | 0.049 | ||
| 322 | rs4671393 | hydroxyurea | Efficacy | yes | Allele A is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele G. | A | A | OR | 0.047 |
| 323 | rs396991 | rituximab | Efficacy | yes | Genotype AA is associated with decreased response to rituximab in people with Neuromyelitis Optica as compared to genotype CC. | A | OR | 0.04 | |
| 324 | rs191190 | ustekinumab | Efficacy | yes | Genotypes CC + CT is associated with decreased response to ustekinumab in people with Psoriasis as compared to genotype TT. | OR | 0.035 | ||
| 325 | rs1062613 | clozapine | Efficacy | yes | Allele T is associated with increased response to clozapine in people with Schizophrenia as compared to allele C. | T | OR | 0.035 |
It is not enough to have "centenarian" genes to become one: You have to cut down Your health risks before. This section contains information about the risk of developing chronic age-related diseases: cardiovascular, cancer, mental health, chronic inflammation, bone and muscle diseases, and lung diseases.
Hereditary Cancers are caused by a genetic defect that determines a higher-than-normal risk of developing cancer. Hereditary cancers can have an impact on longevity, as individuals with certain genetic mutations that increase the risk of cancer may have a shorter life expectancy. The report includes about 300 genes, related to cancer predisposition, progression and tumor cell motility.
| # | Chrom | Position | Gene | RSID | cDNA Change | Zygosity | Allele Frequency | Phenotype Name | Significance | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | chr9 | 95174077 | FANCC | rs7850958 | c.346-1930T>C | hom | 0.461417977241 | not provided | Uncertain significance | |
| 2 | chr8 | 11758901 | GATA4 | rs1062219 | c.*426C>T | hom | 0.320965164589 | not provided | Uncertain significance | |
| 3 | chr7 | 140734798 | BRAF | None | c.2128-28dup | het | None | Noonan syndrome with multiple lentigines|Cardio-facio-cutaneous syndrome|Noonan syndrome|not specified | Conflicting interpretations of pathogenicity | |
| 4 | chr6 | 152121769 | ESR1 | None | c.851-3487del | het | 0.453276658411 | Cerebellar ataxia|Emery-Dreifuss muscular dystrophy | Uncertain significance | |
| 5 | chr6 | 151842200 | ESR1 | rs2234693 | c.453-397T>C | het | 0.472820185244 | Myocardial infarction, susceptibility to | risk factor | |
| 6 | chr5 | 177093242 | FGFR4 | rs351855 | c.1162G>A | hom | 0.321121756917 | See cases|Cancer progression and tumor cell motility|not specified | Conflicting interpretations of pathogenicity | |
| 7 | chr4 | 54738809 | KIT | rs376694515 | c.*252G>T | het | 0.00150015959145 | Partial albinism|Mastocytosis|Gastrointestinal stromal tumor | Uncertain significance | |
| 8 | chr4 | 54296368 | PDGFRA | None | c.*1109_*1111del | het | 0.233246463142 | Gastrointestinal stromal tumor|Idiopathic hypereosinophilic syndrome | Uncertain significance | |
| 9 | chr3 | 12583766 | RAF1 | None | c.*745_*748dup | het | 0.0100082871167 | Noonan syndrome with multiple lentigines|Noonan syndrome | Uncertain significance | |
| 10 | chr3 | 10152482 | VHL | None | c.*2540_*2545del | hom | 0.283872598584 | Von Hippel-Lindau syndrome | Uncertain significance | |
| 11 | chr22 | 41179881 | EP300 | None | c.*966_*967del | het | 0.0836860330896 | Rubinstein-Taybi syndrome due to CREBBP mutations | Uncertain significance | |
| 12 | chr22 | 29628628 | NF2 | None | c.115-8101del | het | None | Neurofibromatosis, type 2 | Uncertain significance | |
| 13 | chr2 | 47414421 | MSH2 | None | c.942+28_942+29del | het | 0.100136282961 | Lynch syndrome|Lynch syndrome 1|Hereditary nonpolyposis colorectal neoplasms|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 14 | chr18 | 51084013 | SMAD4 | rs1555688055 | c.*5546_*5547insGCAC | het | 0.0558176100629 | Myhre syndrome|Telangiectasia, hereditary hemorrhagic, type 1|Juvenile Polyposis | Uncertain significance | |
| 15 | chr17 | 42314852 | STAT3 | None | c.*893dup | het | 0.0704885343968 | Hyper-IgE syndrome | Uncertain significance | |
| 16 | chr17 | 17212960 | FLCN | rs775700421 | c.*695C>T | het | 0.00086031098649 | Multiple fibrofolliculomas|Familial spontaneous pneumothorax | Uncertain significance | |
| 17 | chr17 | 7668837 | TP53 | None | c.*772del | hom | 0.631307090039 | Li-Fraumeni syndrome | Uncertain significance | |
| 18 | chr16 | 89816741 | FANCA | rs11275235 | c.-138_-126dup | het | 0.397195961155 | not specified|not provided | Conflicting interpretations of pathogenicity | |
| 19 | chr16 | 56831918 | NUP93 | rs145146218 | c.1162C>T | het | 0.000781664485552 | Nephrotic syndrome|Nephrotic syndrome, type 12|not provided | Conflicting interpretations of pathogenicity | |
| 20 | chr16 | 2080258 | TSC2 | rs45448801 | c.3491C>T | het | 0.000120724060305 | Tuberous sclerosis 2|Hereditary cancer-predisposing syndrome|Tuberous sclerosis syndrome|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 21 | chr15 | 98963214 | IGF1R | None | c.*5789del | hom | 0.636829615567 | Growth delay due to insulin-like growth factor I resistance | Uncertain significance | |
| 22 | chr15 | 98959855 | IGF1R | None | c.*2426del | hom | 0.635246216486 | Growth delay due to insulin-like growth factor I resistance | Conflicting interpretations of pathogenicity | |
| 23 | chr15 | 38352242 | SPRED1 | None | c.*590_*595dup | het | 0.0101997146933 | Legius syndrome | Uncertain significance | |
| 24 | chr14 | 95090172 | DICER1 | None | c.*326del | hom | 0.676011739265 | Pleuropulmonary blastoma | Uncertain significance | |
| 25 | chr12 | 120978819 | HNF1A | rs1169289 | c.51C>G | het | 0.464474334812 | Type 2 diabetes mellitus|Maturity-onset diabetes of the young type 3|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 26 | chr12 | 114684072 | TBX3 | rs1555208536 | c.-875_-872dup | hom | 0.41619021057 | Ulnar-mammary syndrome|not provided | Conflicting interpretations of pathogenicity | |
| 27 | chr11 | 22623348 | FANCF | rs45554234 | c.*1338dup | hom | 0.959894071852 | Fanconi anemia | Uncertain significance | |
| 28 | chr11 | 535463 | HRAS | rs8176336 | c.-101C>T | hom | 0.110307931063 | Noonan syndrome and Noonan-related syndrome|not provided | Conflicting interpretations of pathogenicity | |
| 29 | chr10 | 87966903 | PTEN | None | c.*1458_*1459del | het | 0.231438812084 | PTEN hamartoma tumor syndrome | Uncertain significance | |
| 30 | chr10 | 8074279 | GATA3 | None | c.*265dup | hom | 0.736817420436 | Hypoparathyroidism, deafness, renal disease syndrome|not provided | Conflicting interpretations of pathogenicity | |
| 31 | chr10 | 8054744 | GATA3 | None | c.-503_-502dup | het | 0.32433898974 | Hypoparathyroidism, deafness, renal disease syndrome | Uncertain significance | |
| 32 | chr1 | 241500603 | FH | None | c.1237-18_1237-13dup | het | 0.208943747471 | Hereditary leiomyomatosis and renal cell cancer|Fumarase deficiency|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 33 | chr1 | 241500603 | FH | None | c.1237-16_1237-13dup | het | 0.251112909753 | Hereditary leiomyomatosis and renal cell cancer|Fumarase deficiency|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 34 | chr1 | 161362517 | SDHC | rs201210474 | c.*84G>C | het | 0.00554288917959 | Pheochromocytoma|Gastrointestinal stromal tumor|Paragangliomas 3|Hereditary pheochromocytoma-paraganglioma|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 35 | chr1 | 158668076 | SPTA1 | None | c.1834-16_1834-14del | het | 0.285708830184 | Elliptocytosis|Pyropoikilocytosis, hereditary|Spherocytosis, Recessive|not provided | Conflicting interpretations of pathogenicity | |
| 36 | chr1 | 158618068 | SPTA1 | rs28525570 | c.6531-12C>T | het | 0.255028054441 | Hemolytic anemia|Pyropoikilocytosis, hereditary|Elliptocytosis 2|Hereditary spherocytosis type 3|not specified|not provided | Conflicting interpretations of pathogenicity | |
| 37 | chr1 | 158611132 | SPTA1 | None | c.*131_*132del | het | 0.319211377831 | Elliptocytosis|Pyropoikilocytosis, hereditary|Spherocytosis, Recessive | Uncertain significance |
Coronary artery disease (CAD) is a condition in which the blood vessels that supply the heart muscle with oxygen and nutrients become narrowed or blocked, leading to reduced blood flow to the heart. Age is a major risk factor for CAD, as the risk of developing CAD increases with age. Genetic factors plays an important role in the development of coronary artery disease (CAD).
This report contains data of PRS for coronary disease development (PGS000818) and the list with genes, associated with an increased risk of CAD.
However, it's important to note that genetics is just one of many factors that contribute to the development of CAD, and having a genetic predisposition to the disease does not necessarily mean that an individual will develop it.
How to read the result?
PRS is represented as a percentile within a given population. For example, you have the 70th percentile, which means your personal genetic risk of the disease development is higher than 70 out of every 100 people in a chosen population.
So percentile ＞50 shows an increased risk, ＜50 - decreased one.
| Title | Coronary heart disease (PGS000818) | |
| Sum | 0.5998000000000002 | |
| Count/total | 58/138 | |
| Average | 0.0051706896551724155 | |
| Percentile | 13% |
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs8055236 | CDH13 | G | G/G | PMID 17554300; PMID 19956433; PMID 20017983; | European | [PMID 17554300]: 6 x 10-6 | -1.7 | |
| 2 | rs4977574 | CDKN2B-AS1 | G | G/A | PMID 17478681; PMID 21378990; PMID 21378988; PMID 24916648; PMID: 30278588 | European; Asian | [PMID 29263402]: 1 x 10-7; [PMID 21239051]: 1 x 10-14; | -1.3 | |
| 3 | rs17465637 | MIA3 | C | C/C | PMID: 35768776; PMID 19956433; PMID 21804106; PMID 21984477; PMID 21264445; | European; Iranian; | [PMID 17634449]: 1 x 10-6; [PMID 21378990]: 1 x 10-8; | -1.2 | |
| 4 | rs599839 | SORT1 | A | A/A | PMID: 32858814; PMID 33321069; PMID: 17634449; PMID 18262040; PMID 19380133; PMID 19660754; PMID 19750184; | European | [PMID 33321069]: 2 x 10-7 | -1.2 | |
| 5 | rs17228212 | SMAD3 | C | C/T | PMID 17634449; PMID 19750184; PMID 19956433; PMID 20017983; PMID 21804106; | European | [PMID 17634449]: 2 x 10-7 | -1.1 | |
| 6 | rs1122608 | LDLR | G | G/G | PMID: 27664493; PMID 23380588; PMID 23202125; PMID 20810930; PMID 19956433; PMID: 33321069; PMID 21378990; | European; Asian | [PMID: 33321069]: 5 x 10-7; [PMID 21378990]: 1 x 10-9 | -1.0 | |
| 7 | rs383830 | APC | A | A/A | PMID 26436499; PMID 17554300; PMID 21804106; PMID 19956433; PMID 21804106; | European | -0.9 | ||
| 8 | rs1746048 | CXCL12 (LINC02881) | C | C/C | PMID: 28614256; PMID 19956433; PMID 23531450; PMID 21378990; PMID 33632238; PMID 21378990; | European; Asian | [PMID 33632238]: 1 x 10-6; [PMID 21378990]:3 x 10-10; | -0.9 | |
| 9 | rs7250581 | G | G/G | PMID 19955471; PMID 19956433; PMID 17554300; | European | -0.8 | |||
| 10 | rs12413409 | CNNM2 | G | G/G | PMID 21378988; PMID 24262325; PMID: 21378990; PMID: 31228190; PMID 21378990; | European | [PMID 21378990]: 1 x 10-9 | -0.8 | |
| 11 | rs11206510 | PCSK9 | T | C/T | PMID 20864672; PMID 21378990; | Multiethnic; Asian | [PMID 26343387]: 2 x 10-8; [PMID 32469254]: 1 x 10-8; | -0.6 | |
| 12 | rs7692387 | GUCYA3 | G | G/G | PMID: 31228190; PMID 23202125; PMID 31883534; | European; Chinese | [PMID: 29212778]: Discovery sample description: up to 122,733 cases, up to 424,528 controls | -0.5 | |
| 13 | rs55730499 | LPA | T | T/T | PMID: 26343387 | Multiethnic; | [PMID 26343387]: 5 x 10-39 | -0.4 | |
| 14 | rs3184504 | SH2B3 | T | C/T | PMID 24262325; PMID 21378990; PMID 26343387; | Multiethnic | -0.1 | ||
| 15 | rs964184 | ZPR1 | G | C/C | PMID 19060906; PMID 20864672; PMID 21378990; PMID 22003152; PMID 21378990; PMID 28714975; | European | [PMID 28714975]: 5 x 10-6; [PMID 21378990]: 1 x 10-17; | 0.0 | |
| 16 | rs515135 | APOB | T | C/C | PMID 23202125; PMID: 30507093; PMID 29212778; | European | [PMID 29212778]: 6 x 10-17 | 0.0 | |
| 17 | rs2943634 | C | C/A | PMID 17634449; PMID 23659870; PMID 22042884; PMID 19956433; PMID 19750184; PMID 22207032; | European | [PMID 17634449]: 2 x 10-7 | 0.0 | ||
| 18 | rs11591147 | PCSK9 | T/G | PMID 30104761; PMID 28714975; PMID 23083789; PMID 18193044; | European; | [PMID 30104761]: 2 x 10-12; [PMID 28714975]: 3 x 10-10 | 0.7 | ||
| 19 | rs6922269 | MTHFD1L | A | A/G | PMID 17634449; PMID 17554300; PMID 19164808; PMID 22216278; PMID 17634449; | European | [PMID 17634449]: 3 x 10-8; | 0.7 | |
| 20 | rs1333049 | CDKN2B-AS1 | C | C/G | PMID 17634449, PMID 18362232; PMID 20031606; PMID 19171343; PMID 18979498; PMID 24573017; PMID 23202125; PMID 22623978; PMID 17554300; PMID 33321069; | European; Multiethnic; | [PMID 17554300]: 1 x 10-13; [PMID 33321069]: 5 x 10-18; | 0.9 |
Timely detection and diagnosis of heart disorders can lead to enhanced treatment options, help to prevent sudden cardiac death, and improve prognosis. This report analyzes the most relevant genes for arrhythmias, congenital heart disease, and cardiomyopathies. Analyzed gene abnormalities may cause the following syndromes: Long and short QT, Brugada syndrome, catecholaminergic polymorphic ventricular tachycardia, cardiomyopathies dilated and hypertrophic, and congenital heart defects. In addition, this panel includes vascular abnormalities, such as dolichoectasia and hereditary hemorrhagic telangiectasia.
| # | Gene | rsID | cDNA change | Your genotype | Sequence ontology | SIFT prediction | Allele Frequency | Significance | ClinVar ID | OMIM | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | DMD | rs1801187 | c.5234G>A | T/T | MIS | Damaging | 0.513357050928 | Benign | 94657 | 302045; 310200 | |
| 2 | FKTN | rs34787999 | c.608G>A | A/A | MIS | Damaging | 0.249202580096 | Benign/Likely benign | 93522 | 253800; 611588; 611615; 613152 | |
| 3 | KCNH2 | rs958442820 | c.2735G>A | T/C | MIS | Tolerated | 5.26315789474e-05 | Uncertain significance | 527012 | 527012 | |
| 4 | PKD1L1 | rs2686817 | c.934G>T | A/C | MIS | Damaging | 0.493475262581 | Benign | 1237805 | 1237805 | |
| 5 | NME8 | rs56128139 | c.1478T>C | C/T | MIS | Damaging | 0.271294673582 | Benign | 178811 | 178811 | |
| 6 | NME8 | rs62001869 | c.1007G>A | A/G | MIS | Damaging | 0.0157295398914 | Benign | 226853 | 610852 | |
| 7 | NME8 | rs10250905 | c.622T>C | C/T | MIS | Damaging | 0.736013477567 | Benign | 164801 | 164801 | |
| 8 | DNAH11 | rs2003417 | c.7756T>C | C/T | MIS | Damaging | 0.0372413741442 | Benign/Likely benign | 163111 | 163111 | |
| 9 | DNAAF5 | rs4720951 | c.1895T>C | C/T | MIS | Damaging | 0.433830778724 | Benign | 260930 | 260930 | |
| 10 | DNAAF5 | rs6946758 | c.1784-1298C>G | G/C | INT | Damaging | 0.427423699075 | Benign | 1185315 | 1185315 | |
| 11 | SYNE1 | rs4407724 | c.10191C>A | T/T | SYN | Damaging | 0.658192709733 | Benign | 130388 | 130388 | |
| 12 | SYNE1 | rs4645434 | c.12180G>T | A/A | MIS | Damaging | 0.580499724183 | Benign | 130397 | 610743; 612998 | |
| 13 | ANK2 | rs36210417 | c.9854T>C | C/T | MIS | Damaging | 0.00863359900073 | Benign/Likely benign | 190528 | 600919 | |
| 14 | MYLK | rs9840993 | c.439C>T | A/A | MIS | Damaging | 0.94149056791 | Benign | 198606 | 613780 | |
| 15 | RAF1 | rs759107333 | c.1420A>G | C/T | MIS | Damaging | 7.95772854596e-06 | None | None | None | |
| 16 | TBX1 | rs4819522 | c.1049C>T | T/T | MIS | Damaging | 0.207468145769 | Benign | 403525 | 403525 | |
| 17 | GATA5 | rs113068438 | c.8A>G | C/T | MIS | Damaging | 0.00586321781789 | Benign | 180366 | 180366 | |
| 18 | TTN | rs10497520 | c.3601A>G | C/C | MIS | Damaging | 0.688710066049 | Benign | 46973 | 600334; 604145; 608807; 611705; 603689 | |
| 19 | TTN | rs2291311 | c.9781G>A | T/T | MIS | Damaging | 0.844463342901 | Benign | 47692 | 600334; 604145; 608807; 611705; 603689 | |
| 20 | DNAAF3 | rs2365725 | c.875A>G | C/T | MIS | Damaging | 0.171971791255 | Benign/Likely benign | 257676 | 606763 | |
| 21 | RYR1 | rs2071089 | c.9186A>G | G/A | SYN | Damaging | 0.322394110213 | Benign | 93306 | 93306 | |
| 22 | NOTCH3 | rs11670799 | c.1487C>T | A/G | MIS | Damaging | 0.011983974782 | Benign/Likely benign | 256120 | 125310 | |
| 23 | NOTCH3 | rs4809029 | c.5913+28T>G | C/C | INT | Damaging | 0.868945990553 | Benign | 811011 | 811011 | |
| 24 | DTNA | rs9944927 | c.*2593G>A | A/G | UT3 | Damaging | 0.219157079015 | Benign | 137181 | 137181 | |
| 25 | CCDC40 | rs7207166 | c.2832+381G>A | A/A | INT | Damaging | 0.711252785343 | Benign | 1283901 | 1283901 | |
| 26 | COL1A1 | rs781614679 | c.3754C>T | A/G | MIS | Damaging | 1.19636305631e-05 | Uncertain significance | 1037654 | 1037654 | |
| 27 | JUP | rs41283425 | c.425G>A | T/C | MIS | Damaging | 0.0438894050371 | Benign/Likely benign | 45851 | 601214; 611528 | |
| 28 | GAS8 | rs17178299 | c.776G>A | A/G | MIS | Damaging | 0.0526985397651 | Benign | 402892 | 402892 | |
| 29 | MYH11 | rs113964173 | c.5676G>C | G/C | MIS | Damaging | 0.00501641478463 | Benign/Likely benign | 138358 | 132900 | |
| 30 | ALPK3 | rs187316 | c.4259T>C | C/T | MIS | Damaging | 0.226143503793 | Benign | 384691 | 384691 | |
| 31 | DNAAF4 | rs600753 | c.572A>G | C/T | MIS | Damaging | 0.554209658117 | Benign | 262315 | 262315 | |
| 32 | SYNE2 | rs142660236 | c.15794T>C | C/T | MIS | Damaging | 0.0137591284823 | Benign | 130481 | 612999 | |
| 33 | SYNE2 | rs8010699 | c.9926A>G | G/G | MIS | Damaging | 0.804419189222 | Benign | 130521 | 612999 | |
| 34 | SYNE2 | rs8010911 | c.9757G>C | C/C | MIS | Damaging | 0.803822390229 | Benign | 130520 | 612999 | |
| 35 | SYNE2 | rs4027402 | c.6851C>T | T/T | MIS | Damaging | 0.809269092335 | Benign | 130504 | 612999 | |
| 36 | SYNE2 | rs4902264 | c.5906T>C | C/T | MIS | Damaging | 0.807647922039 | Benign | 130501 | 612999 | |
| 37 | SOS2 | rs3736760 | c.2057+38C>T | A/G | INT | Damaging | 0.762008389107 | Benign | 1266724 | 1266724 | |
| 38 | DNAAF2 | rs2985684 | c.186G>C | G/G | MIS | Damaging | 0.64203724391 | Benign | 95893 | 612518 | |
| 39 | MMP3 | rs679620 | c.133A>G | C/T | MIS | Damaging | 0.578682343782 | Benign | 403098 | 403098 | |
| 40 | MYBPC3 | rs3729986 | c.472G>A | T/C | MIS | Damaging | 0.0662396894711 | Benign | 42758 | 615396; 115197 | |
| 41 | BAG3 | rs2234962 | c.451T>C | C/T | MIS | Damaging | 0.170283253861 | Benign/Likely benign | 44783 | 612954; 613881 | |
| 42 | MYPN | rs7079481 | c.3403C>A | A/A | MIS | Damaging | 0.430328419891 | Benign | 31800 | 615248 | |
| 43 | CACNB2 | rs58225473 | c.1965T>G | G/T | MIS | Damaging | 0.137294962562 | Benign | 136649 | 611876 | |
| 44 | CPT2 | rs1799822 | c.1939A>G | G/A | MIS | Damaging | 0.162231592375 | Benign | 92433 | 600649; 608836 | |
| 45 | SELENON | rs2294228 | c.1506C>A | A/A | MIS | Damaging | 0.771142168881 | Benign | 95959 | 602771 |
Lipid metabolism plays an important role in the development of heart disease, and this risk increases with age. Cholesterol is a type of lipid that is carried in the blood by lipoproteins, including low-density lipoprotein (LDL) and high-density lipoprotein (HDL). LDL is often referred to as "bad" cholesterol, as high levels of LDL are associated with an increased risk of CAD. HDL, on the other hand, is often referred to as "good" cholesterol, as it helps to remove cholesterol from the bloodstream and may have a protective effect against CAD. As we age, our lipid metabolism tends to change. For example, LDL cholesterol levels tend to increase, while HDL cholesterol levels tend to decrease. This can increase the risk of CAD and other heart diseases.
Genetics plays an important role in lipid metabolism and the development of heart disease. Genes control the production, transport, and metabolism of cholesterol and other lipids.
This report contains data of the PRS of Coronary atherosclerosis development (PGS001839), and the list with genes, associated with an increased risk of CAD. It's important to note, however, that genetics is just one of many factors that contribute to lipid metabolism and the development of heart disease. Lifestyle factors, such as diet and physical activity, are also important contributors to lipid metabolism and the development of heart disease, and they can modify the effects of genetic factors.
How to read the result?
PRS is represented as a percentile within a given population. For example, you have the 70th percentile, which means your personal genetic risk of the disease development is higher than 70 out of every 100 people in a chosen population.
So percentile ＞50 shows an increased risk, ＜50 - decreased one.
| Title | Coronary atherosclerosis (PGS001839) | |
| Sum | 0.5174837117616977 | |
| Count/total | 15921/25425 | |
| Average | 1.625160830857665e-05 | |
| Percentile | 3% |
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs429358 | APOE | C | CT | [PMID 20429872]; [PMID 34887591]; [PMID: 34887591]; | European; Asian; African; | 6,00E-256 | -1.5 | |
| 2 | rs268 | LPL | G | GG | [PMID 22399527]; [PMID: 20429872]; [PMID 16741292]; [PMID 16651467]; | European; | 2,00E-12 | -1.0 | |
| 3 | rs12740374 | CELSR2 | G | TT | [PMID: 18262040]; [PMID: 25350695]; [PMID: 28577571]; | European; African; | 2,00E-26 | -0.8 | |
| 4 | rs12740374 | CELSR2 | G | TT | [PMID: 18262040]; [PMID: 25350695]; [PMID: 28577571]; | European; African; | 4,00E-202 | -0.8 | |
| 5 | rs7679 | PCIF1 | C | CC | [PMID: 19060906]; [PMID: 19965587]; | European; | 7,00E-11 | -0.8 | |
| 6 | rs1800961 | HNF4A | T | TT | [PMID: 24097068]; [PMID: 18660489]; [PMID: 30698716]; | European; | 2,00E-34 | -0.8 | |
| 7 | rs708272 | CETP | G | GG | [PMID 18560005]; [PMID 20031564]; [PMID: 27608031]; [PMID: 31739638]; [PMID: 34503513]; | European; Han Chinese; Asian; Western Siberia; | 3,00E-11 | -0.5 | |
| 8 | rs6756629 | ABCG8, ABCG5 | G | GG | [PMID: 20832063]; [PMID:19060911]; | European; | 3,00E-06 | -0.5 | |
| 9 | rs328 | LPL | G | GC | [PMID: 18193044]; [PMID: 30944368]; [PMID: 19148283]; | European; African | 2,00E-28 | -0.4 | |
| 10 | rs2967605 | RAB11B | T | TT | [PMID: 29507422]; | European; | 8,00E-09 | -0.3 |
Thrombophilia is a condition in which an individual has an increased tendency to develop blood clots. This can be caused by genetic or acquired factors, and the risk of developing thrombophilia increases with age. Thrombophilia risk has a strong genetic component, as certain genetic mutations can increase the risk of developing blood clots. The most common genetic mutations associated with thrombophilia are mutations in the genes that control the production and function of clotting factors.
This report contains data of blood clot or deep vein thrombosis (PGS000931), and the list with genes, associated with an increased risk of thrombophilia.
However, it's important to note that having a genetic mutation does not necessarily mean that an individual will develop thrombophilia. Other factors, such as lifestyle factors and medical conditions, can also contribute to the development of thrombophilia.
How to read the result?
PRS is represented as a percentile within a given population. For example, you have the 70th percentile, which means your personal genetic risk of the disease development is higher than 70 out of every 100 people in a chosen population.
So percentile ＞50 shows an increased risk, ＜50 - decreased one.
| Title | Blood clot or deep vein thrombosis (PGS000931) | |
| Sum | 0.27972496455000007 | |
| Count/total | 329/512 | |
| Average | 0.0004251139278875381 | |
| Percentile | 97% |
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs1801133 | MTHFR | A | AG | [PMID: 30466296]; [PMID: 20031578]; [PMID: 34707639]; | European; East Asians; West Asians; | [PMID: 20031578]: 8 x 10-35; [PMID: 34707639]: 4 x 10-104; | -1.3 | |
| 2 | rs1799889 | SERPINE | G | GG | [PMID 9700201]; [PMID 16424345]; [PMID 25020710]; [PMID: 17896948]; | None | None | -1.3 | |
| 3 | rs1800790 | FGB | A | AG | [PMID 29235504]; [PMID: 31354890] | None | None | -0.3 | |
| 4 | rs8176719 | ABO | C | C- | [PMID: 22672568]; [PMID 21463476]; | European | [PMID: 22672568]: 6 x 10-12 | -0.3 | |
| 5 | rs2519093 | ABO | T | CC | [PMID: 21463476]; [PMID: 33512453]; [PMID: 31420334] | European; African American; | [PMID: 31420334]: 4 x 10-169 | 0.0 | |
| 6 | rs6025 | F5 | T | TT | [PMID 28373160]; [PMID 23900608]; [PMID 14996674]; [PMID 10666427]; [PMID 10477778]; | European; African American; | [PMID: 31676865]: 1 x 10-300; | 0.0 | |
| 7 | rs1799963 | F2 | A | AA | [PMID 23900608]; [PMID 19404532];[PMID 22784820]; | European | [PMID: 26908601]:1 x 10-24 | 0.0 | |
| 8 | rs5918 | ITGB3 | C | CC | [PMID 8598867]; [PMID 9700201]; [PMID 11723016]; [PMID 19786296] | None | None | 0.0 | |
| 9 | rs2036914 | F11 | C | CC | [PMID: 19583818]; [PMID: 31420334]; [PMID 21232005]; [PMID 23150947]; [PMID: 25091233] | European; African Americans | [PMID 31420334]: 2 x 10-54 | 0.0 |