This report is based on your raw file genome’s data cross-referencing against available genetic databases and constructing a report based on interpretations in these databases. Variant annotations were made with
OakVar. Annotation databases that was used for report generating: cadd_exome, gnomAD, pubmed, clinpred, clinvar, ncbigene, omim, prec, provean, revel, sift, LongevityMap.
Attention! The information provided is just for informational purposes. Its clinical implementation is possible just after consulting your healthcare practitioner. All drugs, vitamins and lifestyle changes may be prescribed just by your healthcare practitioner, based on clinical blood test results, family history etc. Genetical testing just provides additional information about possible health risk and risk management.
The report consists of:
This report estimates how many significant longevity variations you have and whether its "a lot" or "not so" for your population. The data for this report is obtained mainly by studying centenarians’ genomes.
The longevity variants report is based on 1900 variants from LongevityMap ( genomics.senescence.info/longevity ) and other data sources which are scored and prioritized according to multiple criteria. It also depends on ClinGene, dbSNP and ClinVar modules.
In the table you can see, how many significant for your population variants were found in your genome. Positively longevity-associated variants are marked with green, negatively associated - with red.
We have analyzed genes that affect different longevity pathways in your genome. We have divided them according to the longevity pathways they contribute to. So you can see which of them “work well” and which do not so.
Longevity pathways encompass a fascinating realm of biological processes and signaling pathways that play a crucial role in regulating aging and lifespan. Recent advancements in our understanding of these pathways have yielded valuable insights, including the identification of specific genes that impact the aging process [PMID:33891896].
To help you better understand the role your genes play in longevity, we have categorized them into 11 distinct groups.
Our analysis has allowed us to identify which of your genes contribute to different longevity pathways, giving you a clearer picture of which genes are performing well and which ones may need additional attention.
Lipids play crucial roles in regulating aging and longevity. Lipids are key biological molecules that contribute to cellular and organismal functions in three principal ways. First, they are fundamental structural elements of cellular membranes. Second, they are key molecules in energy metabolism to fuel the cell. Third, they play roles by acting as signaling molecules. Lipid metabolism is not considered a separate longevity pathway, but genes that regulate lipid transfer, like APOE and CETP, show the strongest association with longevity. This is a list of genes we analyzed in your genotype related to lipid transfer:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs429358 | multiple | APOE | C/T | T | C | het | -0.5 | |
| rs4420638 | multiple | APOC1 | G/A | A | G | het | -0.375 | |
| rs405509 | Danish, German, Dutch | APOE | G/G | T | G | hom | -0.3 | |
| rs4784744 | Danish, German, Dutch | CETP | A/G | G | A | het | 0.05 | |
| rs7524519 | American (Caucasian) | LYPLAL1 | G/A | A | G | het | 0.07 | |
| rs9916344 | American (Caucasian) | PITPNM3 | T/C | C | T | het | 0.07 | |
| rs289714 | Danish, German, Dutch | CETP | A/G | G | A | het | 0.15 | |
| rs1800774 | Danish, German, Dutch | CETP | T/C | C | T | het | 0.15 | |
| rs1501299 | Jordanian | ADIPOQ | G/G | G | G | hom | 0.19 | |
| rs440446 | Danish, German, Dutch | APOE | G/G | C | G | hom | 0.3 | |
| rs1800777 | Danish, German, Dutch | CETP | G/G | G | G | hom | 0.3 | |
| rs662 | multiple | PON1 | T/T | T | T | hom | 0.31 | |
| rs5128 | Danish, German, Dutch | APOC3 | G/G | G | G | hom | 0.45 | |
| rs5882 | multiple | CETP | G/G | G | G | hom | 0.97 |
Beneficial Genotypes:
rs7524519 (LYPLAL1): This SNP is associated with longevity in a study involving centenarians and healthy controls. The individual has a heterozygous genotype (G/A), which is considered beneficial for longevity. More info on rs7524519.
rs289714 (CETP): This SNP is associated with longevity. The individual has a heterozygous genotype (A/G), which is beneficial for longevity. More info on rs289714.
rs4784744 (CETP): This SNP is associated with longevity. The individual has a heterozygous genotype (A/G), which is beneficial for longevity. More info on rs4784744.
rs1800774 (CETP): This SNP is associated with longevity. The individual has a heterozygous genotype (T/C), which is beneficial for longevity. More info on rs1800774.
rs9916344 (PITPNM3): This SNP is associated with longevity. The individual has a heterozygous genotype (T/C), which is beneficial for longevity. More info on rs9916344.
rs440446 (APOE): This SNP is associated with longevity. The individual has a homozygous genotype (G/G), which is beneficial for longevity. More info on rs440446.
rs5882 (CETP): This SNP is associated with longevity. The individual has a homozygous genotype (G/G), which is beneficial for longevity. More info on rs5882.
rs662 (PON1): This SNP is associated with longevity. The individual has a homozygous genotype (T/T), which is beneficial for longevity. More info on rs662.
rs5128 (APOC3): This SNP is associated with longevity. The individual has a homozygous genotype (G/G), which is beneficial for longevity. More info on rs5128.
rs1800777 (CETP): This SNP is associated with longevity. The individual has a homozygous genotype (G/G), which is beneficial for longevity. More info on rs1800777.
rs1501299 (ADIPOQ): This SNP is associated with longevity in men. The individual has a homozygous genotype (G/G), which is beneficial for longevity. More info on rs1501299.
Detrimental Genotypes:
rs405509 (APOE): This SNP is associated with a decreased likelihood of longevity. The individual has a homozygous genotype (G/G), which is detrimental for longevity. More info on rs405509.
rs429358 (APOE): This SNP is associated with an increased risk of Alzheimer's disease and decreased longevity. The individual has a heterozygous genotype (C/T), which is detrimental for longevity. More info on rs429358.
rs4420638 (APOC1): This SNP is associated with a decreased likelihood of longevity. The individual has a heterozygous genotype (G/A), which is detrimental for longevity. More info on rs4420638.
The presence of multiple beneficial genotypes in the CETP gene (rs289714, rs4784744, rs1800774, rs5882, rs1800777) suggests a strong positive interaction that may amplify the beneficial effects on lipid metabolism and longevity. However, the presence of detrimental genotypes in the APOE gene (rs405509, rs429358) and APOC1 gene (rs4420638) may mitigate some of these benefits, particularly concerning lipid metabolism and Alzheimer's disease risk.
Longevity Related Risks:
The individual has several beneficial genotypes associated with longevity, particularly in the CETP and APOE genes. However, the presence of detrimental genotypes in the APOE and APOC1 genes may increase the risk of decreased longevity and Alzheimer's disease.
General Risks:
The presence of the rs429358 SNP in the APOE gene is associated with an increased risk of Alzheimer's disease. Additionally, the rs405509 SNP in the APOE gene is associated with a decreased likelihood of longevity.
Lifestyle Changes: Regular physical activity, a balanced diet rich in antioxidants, and maintaining a healthy weight can help mitigate some of the risks associated with the detrimental genotypes.
Dietary Adjustments: A diet low in saturated fats and high in omega-3 fatty acids can help improve lipid metabolism and reduce the risk of cardiovascular diseases.
Medical Interventions: Regular monitoring of lipid levels and cognitive function can help in early detection and management of potential health issues. Medications to manage cholesterol levels and cognitive health may also be considered.
The presence of multiple beneficial genotypes in the CETP gene suggests a strong genetic predisposition for healthy lipid metabolism, which is a positive indicator for cardiovascular health. However, the detrimental genotypes in the APOE and APOC1 genes highlight the importance of regular health check-ups and proactive management of potential health risks.
The insulin/insulin-like growth factor (IGF-1) signaling pathway is a key regulator of metabolism, growth, and aging. It has been extensively studied in various model organisms, including worms, flies, and mice, and is also thought to play an important role in human aging and longevity. This pathway is also involved in glucose metabolism. This is a list of genes we analyzed in your genotype related to insulin/IGF-1 signaling pathway:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs2267723 | Danish | GHRHR | G/A | A | G | het | -0.11 | |
| rs5771675 | American (Caucasian) | FAM19A5 | G/A | A | G | het | 0.065 | |
| rs3842755 | Danish | INS | A/C | C | A | het | 0.11 | |
| rs216493 | American (Caucasian) | PLEKHA7 | G/G | A | G | hom | 0.14 | |
| rs155979 | Korean | PCSK1 | C/C | G | C | hom | 0.14 | |
| rs9899404 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs3782415 | American (Caucasian) | SOCS2 | T/T | T | T | hom | 0.14 | |
| rs4918255 | American (Caucasian) | SORCS1 | T/T | T | T | hom | 0.14 | |
| rs6812745 | American (Caucasian) | SORCS2 | A/A | A | A | hom | 0.14 | |
| rs768023 | German | A/G | G | A | het | 0.175 | ||
| rs572169 | Danish | GHSR | T/T | C | T | hom | 0.22 | |
| rs1002149 | Danish | GSR | G/G | G | G | hom | 0.22 | |
| rs6911407 | German | A/C | C | A | het | 0.25 | ||
| rs4946936 | Chinese (Han) | FOXO3 | C/T | T | C | het | 0.25 | |
| rs2274776 | German | AFG1L | A/A | A | A | hom | 0.25 | |
| rs2802290 | German | FOXO3 | A/G | G | A | het | 0.3 | |
| rs473268 | German | A/C | C | A | het | 0.35 | ||
| rs479744 | multiple | multiple | T/G | G | T | het | 0.395 | |
| rs9400239 | multiple | FOXO3 | C/T | T | C | het | 0.435 | |
| rs7762395 | multiple | FOXO3 | A/G | G | A | het | 0.445 | |
| rs13217795 | multiple | FOXO3 | T/C | C | T | het | 0.46 | |
| rs2883881 | German | FOXO3 | A/A | A | A | hom | 0.5 | |
| rs2764264 | multiple | FOXO3 | C/C | C | C | hom | 0.87 | |
| rs13220810 | multiple | FOXO3 | T/T | T | T | hom | 0.88 | |
| rs2802288 | multiple | FOXO3 | A/A | A | A | hom | 0.92 | |
| rs2802292 | multiple | FOXO3 | G/G | G | G | hom | 0.95 |
Beneficial Genotypes:
FOXO3 (rs2802292, rs2802288, rs13220810, rs2764264): These SNPs in the FOXO3 gene are associated with increased longevity. Studies have shown that individuals with these variants tend to live longer. For example, rs2802292 has been significantly associated with longevity in multiple populations, including Chinese (Han) and American of Japanese origin. (PubMed: 19793722, PubMed: 18765803)
GHSR (rs572169): This SNP in the GHSR gene is associated with longevity. The GHSR gene plays a role in energy homeostasis and regulation of body weight. (PubMed: 22406557)
INS (rs3842755): This SNP in the INS gene is associated with longevity. The INS gene is involved in insulin signaling, which is crucial for metabolic regulation. (PubMed: 22406557)
Detrimental Genotypes:
GHRHR (rs2267723): This SNP in the GHRHR gene is associated with a decreased likelihood of longevity. The GHRHR gene is involved in growth hormone signaling, and mutations can lead to growth hormone deficiencies. (PubMed: 22406557)
The presence of multiple beneficial SNPs in the FOXO3 gene (rs2802292, rs2802288, rs13220810, rs2764264) may have a synergistic effect, further enhancing the likelihood of increased longevity. Conversely, the detrimental effect of the GHRHR (rs2267723) SNP may be mitigated by the presence of beneficial SNPs in other genes such as FOXO3 and INS.
Longevity Related Risks:
Individuals with beneficial SNPs in the FOXO3 gene (rs2802292, rs2802288, rs13220810, rs2764264) have a higher likelihood of increased longevity. These SNPs are associated with better regulation of apoptosis and stress resistance, which are crucial for long-term health.
The presence of the GHSR (rs572169) and INS (rs3842755) SNPs also contributes positively to longevity by enhancing metabolic regulation and energy homeostasis.
General Risks:
The GHRHR (rs2267723) SNP is associated with a risk of growth hormone deficiencies, which can lead to short stature and other metabolic issues. This SNP may negatively impact overall health and longevity.
For Beneficial Genotypes:
For Detrimental Genotypes:
The presence of multiple beneficial SNPs in the FOXO3 gene suggests a strong genetic predisposition towards longevity. This can be further supported by a healthy lifestyle, including a balanced diet, regular exercise, and stress management techniques.
The detrimental effect of the GHRHR (rs2267723) SNP can be managed through proactive health monitoring and medical interventions if necessary. This highlights the importance of personalized healthcare based on genetic profiles.
Antioxidant defense plays an important role in the aging process and longevity. Oxidative stress, which is caused by an imbalance between the production of reactive oxygen species (ROS) and the body's ability to neutralize them, is a major contributor to age-related diseases and the aging process.
The body has various mechanisms to defend against oxidative stress, including antioxidant enzymes such as superoxide dismutase (SOD), catalase, and glutathione peroxidase, as well as non-enzymatic antioxidants such as vitamins C and E, and glutathione. These antioxidants work together to neutralize ROS and prevent damage to cells and tissues.
Studies have shown that increased antioxidant defense can promote longevity and delay the onset of age-related diseases. This is a list of genes we analyzed in your genotype related to antioxidant defense:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs7319813 | American (Caucasian) | ENOX1 | T/C | C | T | het | 0.07 | |
| rs4964735 | Danish | TXNRD1 | A/G | G | A | het | 0.105 | |
| rs7301631 | Danish | TXNRD1 | C/T | T | C | het | 0.105 | |
| rs17202060 | Danish | TXNRD1 | T/C | C | T | het | 0.105 | |
| rs7962759 | Danish | TXNRD1 | G/C | C | G | het | 0.105 | |
| rs7318601 | American (Caucasian) | ENOX1 | A/A | G | A | hom | 0.14 | |
| rs10861169 | Danish | TXNRD1 | T/T | C | T | hom | 0.21 | |
| rs4964728 | Danish | TXNRD1 | A/A | G | A | hom | 0.21 | |
| rs7310505 | Danish | TXNRD1 | C/C | A | C | hom | 0.21 | |
| rs10778318 | Danish | TXNRD1 | G/G | A | G | hom | 0.21 | |
| rs7310815 | Danish | TXNRD1 | C/C | C | C | hom | 0.21 | |
| rs4445711 | Danish | TXNRD1 | G/G | G | G | hom | 0.21 | |
| rs10861203 | Danish | TXNRD1 | G/G | G | G | hom | 0.21 | |
| rs10861197 | Danish | TXNRD1 | T/T | T | T | hom | 0.21 | |
| rs207444 | Danish | XDH | A/A | A | A | hom | 0.22 | |
| rs5746151 | Danish | SOD2 | C/C | C | C | hom | 0.51 | |
| rs5746136 | multiple | SOD2 | C/C | C | C | hom | 0.51 |
Beneficial Genotypes:
rs5746151 (SOD2): This SNP is associated with increased lifespan and physical functioning in the female cohort. The genotype C/C is considered beneficial for longevity.
rs5746136 (SOD2): Similar to rs5746151, this SNP is associated with increased lifespan and physical functioning in the female cohort. The genotype C/C is considered beneficial for longevity.
rs207444 (XDH): This SNP is associated with longevity in Danish populations. The genotype A/A is considered beneficial for longevity.
Detrimental Genotypes:
rs10861169 (TXNRD1): This SNP is associated with physical and cognitive performances but may have a detrimental effect on longevity. The genotype T/T is considered detrimental.
rs4964728 (TXNRD1): Similar to rs10861169, this SNP is associated with physical and cognitive performances but may have a detrimental effect on longevity. The genotype A/A is considered detrimental.
rs7310505 (TXNRD1): Similar to rs10861169, this SNP is associated with physical and cognitive performances but may have a detrimental effect on longevity. The genotype C/C is considered detrimental.
rs10778318 (TXNRD1): Similar to rs10861169, this SNP is associated with physical and cognitive performances but may have a detrimental effect on longevity. The genotype G/G is considered detrimental.
The genotypes in the TXNRD1 gene (rs10861169, rs4964728, rs7310505, rs10778318) may interact to amplify the risk of reduced longevity despite their association with improved physical and cognitive performance. On the other hand, the beneficial genotypes in the SOD2 gene (rs5746151, rs5746136) and XDH gene (rs207444) may mitigate some of these risks by promoting longevity and better physical functioning.
Longevity Related Risks:
The presence of detrimental genotypes in the TXNRD1 gene (rs10861169, rs4964728, rs7310505, rs10778318) may increase the risk of reduced longevity. However, the beneficial genotypes in the SOD2 (rs5746151, rs5746136) and XDH (rs207444) genes may help to counteract these risks.
General Risks:
The genotypes in the TXNRD1 gene are associated with improved physical and cognitive performance, which may reduce the risk of age-related decline in these areas.
Lifestyle Changes: Regular physical exercise and cognitive training can help to maintain physical and cognitive performance, potentially mitigating some of the risks associated with the detrimental TXNRD1 genotypes.
Dietary Adjustments: A diet rich in antioxidants may support the function of the antioxidant pathways, including those involving the TXNRD1 and SOD2 genes. Foods high in selenium, such as Brazil nuts, can support the function of selenoproteins like TXNRD1.
Medical Interventions: Regular health check-ups and monitoring of cognitive and physical health can help to detect and address any issues early. Antioxidant supplements may also be considered, but it is important to consult with a healthcare provider before starting any new supplement regimen.
The presence of beneficial genotypes in the SOD2 and XDH genes suggests a strong antioxidant defense system, which is crucial for longevity and overall health. Maintaining a healthy lifestyle that supports antioxidant function can further enhance these benefits.
For more detailed information on the specific genes and SNPs mentioned, you can refer to the following links: rs5746151 (SOD2), rs5746136 (SOD2), rs207444 (XDH), rs10861169 (TXNRD1), rs4964728 (TXNRD1), rs7310505 (TXNRD1), rs10778318 (TXNRD1).
Mitochondria are the powerhouses of the cell, generating the energy (in the form of ATP) needed for cellular processes. They also play a key role in apoptosis (programmed cell death) and other cellular processes. Mitochondrial dysfunction and increased oxidative stress are believed to play a role in the aging process and age-related diseases. Several genes involved in mitochondrial function have been implicated in longevity. They include UCP genes, genes involved in respiratory chain functioning, SIRT3, PGC1a, and some other genes.
In general, the form of these genes determines how well you are protected from oxidative stress and how effectively your cells generate energy. This is a list of genes we analyzed in your genotype related to mitochondria function:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs6435326 | Danish | NDUFS1 | T/T | A | T | hom | -0.19 | |
| rs9557276 | American (Caucasian) | CLYBL | T/T | G | T | hom | 0.14 | |
| rs3019435 | American (Caucasian) | PRKN | T/T | G | T | hom | 0.14 | |
| rs1042718 | Chinese | ADRB2 | A/A | C | A | hom | 0.195 | |
| rs1042719 | Chinese | ADRB2 | C/C | G | C | hom | 0.195 | |
| rs1042714 | multiple | ADRB2 | G/G | G | G | hom | 0.195 | |
| rs2866164 | multiple | MTTP | C/C | C | C | hom | 0.215 | |
| rs15763 | Italian (Southern) | UCP3 | G/A | A | G | het | 0.245 | |
| rs3781907 | Danish | UCP3 | A/A | A | A | hom | 0.245 | |
| rs11235972 | Danish | UCP3 | G/G | G | G | hom | 0.245 | |
| rs1429842 | American (Caucasian) | SLC25A21 | G/G | G | G | hom | 0.37 | |
| rs6435324 | Danish | NDUFS1 | G/G | A | G | hom | 0.38 | |
| rs9472817 | Italian (Southern) | SLC25A27 | C/C | C | C | hom | 0.49 |
Beneficial Genotypes:
Detrimental Genotypes:
The genotypes associated with the UCP3 gene (rs15763, rs3781907, rs11235972) and NDUFS1 gene (rs6435324, rs6435326) suggest a significant interaction in mitochondrial function and longevity. Variants in UCP3 are associated with both beneficial and detrimental effects on longevity, indicating a complex interaction that may depend on other genetic or environmental factors.
Longevity Related Risks:
General Risks:
To mitigate the risks associated with the identified detrimental genotypes, consider the following strategies:
The presence of multiple beneficial genotypes associated with longevity suggests a favorable genetic profile for extended lifespan. However, the interaction between beneficial and detrimental genotypes, particularly in mitochondrial function, highlights the importance of a holistic approach to health management.
The sirtuin genes (SIRT1-SIRT7) are a family of genes that are involved in regulating cellular processes such as DNA repair, metabolism, and stress response. The sirtuin pathway, which involves the activity of these genes, has been implicated in regulating longevity.
Studies have shown that activation of sirtuins can increase lifespan in several model organisms, including yeast, worms, and mice. This is thought to be due to the role of sirtuins in promoting cellular resilience and protecting cells from damage.
In humans, variations in the SIRT genes have been associated with age-related diseases such as Alzheimer's disease, cardiovascular disease, and cancer. Some studies have also suggested that increased activity of SIRT genes may be associated with increased lifespan and improved healthspan in humans.
This is a list of genes we analyzed in your genotype related to sirtuin pathway:
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs107251 | Danish, German, Dutch | SIRT6 | C/T | T | C | het | 0.15 |
Beneficial Genotypes:
The genotype associated with rs107251 in the SIRT6 gene has been identified as beneficial. This SNP has been associated with increased longevity in multiple studies involving Danish, German, and Dutch populations. The SIRT6 gene plays a crucial role in cellular stress resistance, genomic stability, aging, and energy homeostasis.
Currently, there is no information provided about interactions between different genotypes in this report. However, the beneficial effect of the rs107251 SNP in the SIRT6 gene suggests a positive impact on longevity, potentially interacting with other longevity-associated genes to amplify this effect.
Longevity Related Risks:
The rs107251 SNP in the SIRT6 gene is associated with increased longevity. Individuals carrying this SNP may have a higher likelihood of living longer due to the gene's role in DNA repair, maintenance of telomeric chromatin, and other cellular processes.
General Risks:
No general health risks are associated with the rs107251 SNP in the SIRT6 gene based on the provided information.
Given the beneficial association of the rs107251 SNP in the SIRT6 gene with longevity, individuals may consider lifestyle choices that support the functions of the SIRT6 gene. These could include:
The SIRT6 gene is part of the sirtuin family, which is involved in various critical cellular processes. Research suggests that sirtuins, including SIRT6, play a role in aging and metabolic regulation. Therefore, supporting overall sirtuin function through healthy lifestyle choices may further enhance the beneficial effects of the rs107251 SNP.
MTOR, also known as the mechanistic target of rapamycin, is a gene that encodes for a protein kinase involved in multiple cellular processes, including growth, metabolism, and aging. The mTOR pathway plays a complex role in aging and longevity. On the one hand, activation of the mTOR pathway has been shown to promote cellular growth and proliferation, which may be beneficial for tissue repair and regeneration during early life stages. On the other hand, chronic activation of the mTOR pathway has been implicated in age-related diseases such as cancer, metabolic disorders, and neurodegeneration.
Studies have shown that genetic or pharmacological inhibition of the mTOR pathway can extend the lifespan in a variety of model organisms, including mice, flies, and worms. Additionally, modulation of the mTOR pathway has been shown to improve age-related functional decline and delay the onset of age-related diseases in various animal models.
Genetic variants in the MTOR gene may be associated with differences in lifespan and age-related disease risk.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs1016339 | American (Caucasian) | CCDC85A | T/C | C | T | het | 0.07 | |
| rs4729049 | American (Caucasian) | CDK6 | C/T | T | C | het | 0.07 | |
| rs10937739 | American (Caucasian) | PPP2R2C | C/T | T | C | het | 0.08 | |
| rs3803304 | multiple | AKT1 | C/C | C | C | hom | 0.34 |
Beneficial Genotypes:
rs3803304 (AKT1): This SNP is associated with longevity, particularly in Danish and German populations. Studies have shown a significant association with increased lifespan, especially in Danish men. (PubMed 22929028, PubMed 19489743)
Detrimental Genotypes:
rs1016339 (CCDC85A): This SNP was identified in a genome-wide association study as one of the 281 SNPs that discriminate between centenarians and healthy controls. (PubMed 22279548)
rs10937739 (PPP2R2C): This SNP was identified in a study that connected various genetic variants with longevity. It is part of the phosphatase 2 regulatory subunit B family, which is implicated in the negative control of cell growth and division. (PubMed 22533364)
rs4729049 (CDK6): This SNP was also identified in a genome-wide association study as one of the 281 SNPs that discriminate between centenarians and healthy controls. CDK6 is important for cell cycle G1 phase progression and G1/S transition. (PubMed 22279548)
The genotypes associated with the mTOR pathway (rs1016339, rs10937739, rs4729049, and rs3803304) may interact in complex ways. For instance, while rs3803304 in AKT1 is beneficial for longevity, the other SNPs (rs1016339, rs10937739, and rs4729049) could potentially mitigate this benefit due to their associations with cell growth, division, and cancer risk.
Longevity Related Risks:
rs3803304 (AKT1): This SNP is associated with increased longevity, particularly in Danish men.
General Risks:
rs1016339 (CCDC85A): This SNP may be associated with a reduced likelihood of reaching centenarian status.
rs10937739 (PPP2R2C): This SNP is implicated in the negative control of cell growth and division, which could be associated with cancer risk.
rs4729049 (CDK6): This SNP is associated with cell cycle progression and has been observed in multiple human cancers.
Given the involvement of the mTOR pathway in these genotypes, consider the following strategies:
The mTOR pathway is crucial for cell growth, proliferation, and survival. Modulating this pathway through lifestyle and dietary changes can have significant impacts on health and longevity.
Tumor suppressor genes and cell cycle regulators are not typically considered as "longevity genes" per se, but they do play an important role in the aging process and the development of age-related diseases, including cancer.
One well-known tumor suppressor gene is TP53, which has been shown to play a role in regulating cellular senescence and preventing the accumulation of damaged cells. Similarly, cell cycle regulators such as cyclin-dependent kinases (CDKs) are involved in regulating the timing and progression of cell division. The dysregulation of CDKs has been implicated in a variety of age-related diseases, including cancer and neurodegenerative disorders.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs4977756 | American (Caucasian) | CDKN2B-AS1 | A/G | G | A | het | -0.18 | |
| rs1063192 | American (Caucasian) | CDKN2B | A/G | G | A | het | 0.18 | |
| rs1412832 | American (Caucasian) | CDKN2B-AS1 | T/C | C | T | het | 0.18 | |
| rs3120819 | American (Caucasian) | TP53 | C/A | A | C | het | 0.24 | |
| rs13008689 | American (Caucasian) | TP53 | A/G | G | A | het | 0.24 | |
| rs9616906 | American (Caucasian) | TP53 | A/G | G | A | het | 0.24 | |
| rs10819510 | American (Caucasian) | TP53 | G/A | A | G | het | 0.24 | |
| rs1333049 | multiple | multiple | G/G | G | G | hom | 0.24 | |
| rs189037 | multiple | ATM | A/G | G | A | het | 0.33 | |
| rs1801270 | Italian | CDKN1A | C/C | C | C | hom | 0.34 | |
| rs1059234 | Italian | CDKN1A | C/C | C | C | hom | 0.34 | |
| rs2738679 | American (Caucasian) | WWOX | T/T | T | T | hom | 0.39 | |
| rs1205035 | American (Caucasian) | TP53 | C/C | C | C | hom | 0.48 |
Beneficial Genotypes:
Detrimental Genotypes:
The presence of multiple beneficial genotypes (e.g., rs189037, rs1205035, rs2738679, rs1801270, rs1059234) may collectively enhance longevity. However, the detrimental genotype rs4977756 could potentially mitigate some of these benefits by increasing the risk of cardiovascular diseases and cancers.
Longevity Related Risks:
General Risks:
To mitigate the risks associated with the detrimental genotype rs4977756, consider the following strategies:
The presence of multiple beneficial genotypes related to longevity suggests a strong genetic predisposition for a longer lifespan. However, the presence of the detrimental genotype rs4977756 indicates a need for proactive health management to mitigate associated risks.
The renin-angiotensin system (RAS) plays an important role in the regulation of blood pressure, fluid balance, and electrolyte homeostasis. However, it is also involved in the aging process and the development of age-related diseases.
One of the mechanisms by which RAS influences aging is through the activation of oxidative stress and inflammation. RAS also affects the cardiovascular system and is involved in the development of hypertension, a major risk factor for cardiovascular diseases such as heart attack and stroke. Furthermore, RAS activation has been linked to the development of insulin resistance and metabolic syndrome, which are also associated with aging and age-related diseases.
In addition, RAS has been implicated in the regulation of cellular senescence, a process by which cells lose their ability to divide and contribute to aging and age-related diseases.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs1879417 | Italian (Southern) | NOS1 | T/C | C | T | het | -0.12 | |
| rs422858 | Italian (Northern) and Japanese | AGTR1 | C/C | A | C | hom | 0.225 | |
| rs275653 | Italian (Northern) and Japanese | AGTR1 | G/G | A | G | hom | 0.45 |
Beneficial Genotypes:
rs422858 (AGTR1): This SNP is associated with extreme longevity. The presence of the C/C genotype has been linked to a higher likelihood of living to an advanced age. This was observed in both Italian and Japanese populations. More info on rs422858
rs275653 (AGTR1): Similar to rs422858, this SNP is also associated with extreme longevity. The G/G genotype has been linked to a higher likelihood of living to an advanced age. This was observed in both Italian and Japanese populations. More info on rs275653
Detrimental Genotypes:
rs1879417 (NOS1): The presence of the T/C genotype in this SNP is associated with a decreased probability of attaining longevity. This was observed in a study involving a large sample of individuals aged 19-107 years. More info on rs1879417
The genotypes rs422858 and rs275653 in the AGTR1 gene both contribute positively to longevity. Their combined presence may amplify the beneficial effects on longevity. On the other hand, the presence of the rs1879417 genotype in the NOS1 gene may counteract these benefits to some extent, as it is associated with a decreased probability of attaining longevity.
Longevity Related Risks:
rs1879417 (NOS1): The T/C genotype is associated with a decreased probability of attaining longevity. This suggests a potential risk for a shorter lifespan.
General Risks:
No specific general health risks were identified from the provided genotypes. The focus of the identified SNPs is primarily on longevity.
For rs1879417 (NOS1): To mitigate the potential negative impact on longevity, consider lifestyle changes that promote cardiovascular health, such as regular exercise, a balanced diet rich in antioxidants, and avoiding smoking. Regular health check-ups to monitor cardiovascular health can also be beneficial.
For rs422858 and rs275653 (AGTR1): Continue to maintain a healthy lifestyle that supports cardiovascular health. This includes regular physical activity, a diet low in saturated fats and high in fruits and vegetables, and managing stress levels.
The AGTR1 gene encodes the type 1 receptor for angiotensin II, which is a key regulator of blood pressure and volume in the cardiovascular system. The beneficial genotypes in this gene suggest a potential for better cardiovascular health and longevity. More info on AGTR1
The NOS1 gene is involved in the production of nitric oxide, which plays a crucial role in vascular health. The detrimental genotype in this gene suggests a need for proactive measures to support vascular health. More info on NOS1
The HSP (heat shock protein) genes are a group of genes that encode heat shock proteins, which are a class of chaperone proteins that help to protect cells from stress-induced damage. HSPs have been shown to play a role in a variety of cellular processes, including protein folding, DNA repair, and apoptosis. While the exact mechanisms by which HSPA genes influence aging and longevity are not yet fully understood, it is believed that they may help to protect cells from the accumulation of damage caused by stress and other environmental factors. As such, HSPs and their associated genes may be a promising target for interventions aimed at promoting healthy aging and extending lifespan. Some unfavorable variants in HSP genes have been shown to reduce the ability of cells to respond to stress, leading to increased damage and inflammation.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs1043618 | multiple | HSPA1A | G/G | G | G | hom | 0.19 |
Beneficial Genotypes:
Detrimental Genotypes:
The HSPA1A gene is known for its role in stress response. While no detrimental genotypes were identified, the presence of the G/G genotype may enhance the body's ability to cope with stressors, potentially mitigating risks associated with environmental factors.
Longevity Related Risks:
General Risks:
To optimize health and longevity, consider the following recommendations:
While the current report does not indicate any detrimental genotypes, it is essential to maintain a healthy lifestyle and monitor any changes in health status. Genetic predispositions can be influenced by environmental factors, and proactive health management is crucial.
Chronic inflammation is a major contributor to the aging process. Inflammation is a natural response of the immune system to harmful stimuli, such as pathogens or tissue damage. However, if this response becomes chronic, it can lead to tissue damage and the development of age-related diseases such as Alzheimer's disease, cardiovascular disease, and cancer.
Chronic inflammation is characterized by the sustained activation of the immune system and the release of pro-inflammatory molecules, such as cytokines, chemokines, and reactive oxygen species (ROS). These molecules can damage cellular components, including DNA, proteins, and lipids, leading to cellular dysfunction and death.
In addition, chronic inflammation can also activate other pathways involved in aging, such as the mTOR pathway and the senescence-associated secretory phenotype (SASP), which further exacerbate inflammation and tissue damage. Therefore, reducing chronic inflammation is a promising strategy to promote healthy aging and prevent age-related diseases.
Chronic inflammation can have a genetic component, with certain genes being associated with increased inflammation levels.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs2430561 | multiple | IFNG | T/T | T | T | hom | -0.1075 | |
| rs590211 | American (Caucasian) | PKNOX2 | G/A | A | G | het | 0.07 | |
| rs2232548 | American (Caucasian) | KLRF1 | T/G | G | T | het | 0.07 | |
| rs205499 | American (Caucasian) | TRIM25 | A/G | G | A | het | 0.07 | |
| rs6997589 | American (Caucasian) | SH2D4A | A/G | G | A | het | 0.07 | |
| rs4648884 | American (Caucasian) | RUNX3 | C/T | T | C | het | 0.08 | |
| rs9517320 | American (Caucasian) | STK24 | C/A | A | C | het | 0.08 | |
| rs2251252 | Italian (Southern) | SDC4 | A/G | G | A | het | 0.09 | |
| rs1981429 | Italian (Southern) | SDC4 | T/G | G | T | het | 0.09 | |
| rs1450741 | Korean | LYN | C/T | T | C | het | 0.09 | |
| rs2072454 | Korean | EGFR | T/C | C | T | het | 0.1 | |
| rs73598374 | Italian (Central) | ADA | T/C | C | T | het | 0.115 | |
| rs10491334 | Italian | CAMK4 | C/C | C | C | hom | 0.12 | |
| rs739401 | American (Caucasian) | CARS | C/C | C | C | hom | 0.13 | |
| rs3804474 | American (Caucasian) | LY86 | T/T | C | T | hom | 0.14 | |
| rs3780223 | American (Caucasian) | ADAMTSL1 | C/C | C | C | hom | 0.14 | |
| rs7800926 | American (Caucasian) | CDK14 | G/G | G | G | hom | 0.14 | |
| rs4751140 | American (Caucasian) | EBF3 | T/T | T | T | hom | 0.14 | |
| rs4647992 | American (Caucasian) | NFKB1 | C/C | C | C | hom | 0.14 | |
| rs2963154 | American (Caucasian) | NR3C1 | T/T | T | T | hom | 0.14 | |
| rs8083511 | American (Caucasian) | TNFRSF11A | A/A | A | A | hom | 0.14 | |
| rs4952085 | American (Caucasian) | XDH | G/G | G | G | hom | 0.14 | |
| rs1546518 | Korean | LYN | C/C | G | C | hom | 0.18 | |
| rs3968371 | Korean | LYN | A/A | A | A | hom | 0.18 | |
| rs1027989 | Korean | LYN | G/G | G | G | hom | 0.18 | |
| rs5744256 | Italian | IL18 | G/G | A | G | hom | 0.2 | |
| rs2293347 | Korean | EGFR | C/C | C | C | hom | 0.2 | |
| rs2280789 | Spanish | CCL5 | A/A | A | A | hom | 0.26 | |
| rs282070 | Italian (Southern) | MAP3K7 | C/C | C | C | hom | 0.27 | |
| rs1800795 | multiple | IL6 | C/C | C | C | hom | 0.6 |
Beneficial Genotypes:
Detrimental Genotypes:
There are no specific interactions between the provided genotypes that amplify or mitigate risks. However, the presence of multiple beneficial genotypes related to longevity (e.g., rs5744256, rs73598374, rs2251252, rs282070) suggests a cumulative positive effect on lifespan.
Longevity Related Risks:
General Risks:
To mitigate the risks associated with the identified detrimental genotypes, consider the following strategies:
The presence of multiple beneficial genotypes related to longevity suggests a favorable genetic predisposition for a longer lifespan. Maintaining a healthy lifestyle, including a balanced diet, regular physical activity, and regular health check-ups, can further enhance the positive effects of these genotypes.
Genome maintenance and post-transcriptional processes are both important for maintaining cellular and organismal homeostasis, and both have been implicated in the regulation of longevity.
Genome maintenance is essential for preventing DNA damage and mutations that can lead to age-related diseases and shortened lifespans. Post-transcriptional processes, including RNA splicing, translation, and decay, are important for regulating gene expression and ensuring that proteins are produced at the appropriate levels and times. Dysregulation of these processes can lead to age-related diseases and shortened lifespans.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs2805533 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | A/A | G | A | hom | -0.35 | |
| rs2485662 | American (Caucasians), Italian (Southern), French, Ashkenazi Jewish | LMNA | C/C | T | C | hom | -0.27 | |
| rs414743 | Italian, Ashkenazi Jewish and Japanese | ADARB1 | A/G | G | A | het | -0.175 | |
| rs701176 | American (Caucasian) | PCNX2 | A/G | G | A | het | 0.07 | |
| rs6732163 | American (Caucasian) | BABAM2 | G/A | A | G | het | 0.07 | |
| rs6443429 | American (Caucasian) | TBL1XR1 | C/A | A | C | het | 0.07 | |
| rs1800392 | American (Caucasian) | WRN | T/G | G | T | het | 0.078 | |
| rs8003961 | American (Caucasian) | DLGAP5 | A/A | A | A | hom | 0.14 | |
| rs10510828 | American (Caucasian) | FHIT | A/A | A | A | hom | 0.14 | |
| rs3817530 | American (Caucasian) | UBE2H | T/T | T | T | hom | 0.14 | |
| rs4149965 | multiple | EXO1 | G/G | G | G | hom | 0.145 | |
| rs9876781 | American (Caucasian) | ATRIP | A/A | A | A | hom | 0.16 | |
| rs2838816 | Italian, Ashkenazi Jewish and Japanese | ADARB1 | A/G | G | A | het | 0.175 | |
| rs3024239 | American (Caucasian) | WRN | T/C | C | T | het | 0.195 | |
| rs2953983 | Danish | POLB | G/G | G | G | hom | 0.22 | |
| rs13320360 | Danish | MLH1 | T/T | T | T | hom | 0.24 | |
| rs1776180 | multiple | EXO1 | C/C | C | C | hom | 0.29 | |
| rs3816754 | American (Caucasian) | RAD51D | G/G | G | G | hom | 0.33 | |
| rs1805329 | Danish | RAD23B | C/C | C | C | hom | 0.33 | |
| rs2838809 | Italian, Ashkenazi Jewish and Japanese | ADARB1 | C/C | C | C | hom | 0.35 | |
| rs884949 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | C/C | C | C | hom | 0.35 | |
| rs3898610 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | T/T | T | T | hom | 0.35 | |
| rs2805562 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | G/G | G | G | hom | 0.35 | |
| rs2805543 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | T/T | T | T | hom | 0.35 | |
| rs2805535 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | T/T | T | T | hom | 0.35 | |
| rs2676192 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | C/C | C | C | hom | 0.35 | |
| rs2387653 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | C/C | C | C | hom | 0.35 | |
| rs17294019 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | C/C | C | C | hom | 0.35 | |
| rs1533484 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | C/C | C | C | hom | 0.35 | |
| rs10903420 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | A/A | A | A | hom | 0.35 | |
| rs1007147 | Italian, Ashkenazi Jewish and Japanese | ADARB2 | T/T | T | T | hom | 0.35 |
Beneficial Genotypes:
1. rs2838809 (ADARB1): This SNP is associated with extreme old age in various populations, including Italian, Ashkenazi Jewish, and Japanese. The genotype C/C is considered beneficial for longevity. NCBI Link
2. rs884949 (ADARB2): This SNP is also associated with extreme old age. The genotype C/C is considered beneficial for longevity. NCBI Link
3. rs3816754 (RAD51D): This SNP is associated with longevity in American (Caucasian) populations. The genotype G/G is considered beneficial. NCBI Link
4. rs1776180 (EXO1): This SNP is associated with longevity, particularly in female centenarians. The genotype C/C is considered beneficial. NCBI Link
Detrimental Genotypes:
1. rs2485662 (LMNA): This SNP is associated with several diseases, including muscular dystrophy and progeria syndrome. The genotype C/C is considered detrimental. NCBI Link
2. rs2805533 (ADARB2): This SNP is associated with extreme old age but has mixed results. The genotype A/A is considered detrimental. NCBI Link
3. rs414743 (ADARB1): This SNP is associated with extreme old age but has mixed results. The genotype A/G is considered detrimental. NCBI Link
The interaction between beneficial and detrimental genotypes in the ADARB1 and ADARB2 genes could potentially mitigate or amplify the risks associated with longevity. For example, having both beneficial (rs2838809) and detrimental (rs2805533) genotypes in ADARB1 and ADARB2 may balance out the overall risk for longevity.
Longevity Related Risks:
1. rs2485662 (LMNA): Increased risk for diseases like muscular dystrophy and progeria syndrome, which can affect longevity.
2. rs2805533 (ADARB2): Mixed results in association with extreme old age, indicating a potential risk for reduced longevity.
General Risks:
1. rs414743 (ADARB1): Mixed results in association with extreme old age, indicating a potential risk for various age-related conditions.
1. Lifestyle Changes: Regular physical activity and a balanced diet rich in antioxidants can help mitigate the risks associated with detrimental genotypes.
2. Medical Interventions: Regular health check-ups and early screening for diseases associated with detrimental genotypes (e.g., muscular dystrophy) can help in early intervention and management.
The presence of multiple beneficial genotypes in the ADARB1 and ADARB2 genes suggests a strong genetic predisposition for longevity. However, the presence of detrimental genotypes in the same genes indicates the need for a balanced approach to health management.
Although many genes associated with longevity can be classified into 11 definite pathways, there are other genes that do not fall into these categories, which are presented in this table.
| RSID | Population | Gene | Your genotype | Ref allele | Alt allele | Zygosity | Weight | |
|---|---|---|---|---|---|---|---|---|
| rs3847663 | American | A/G | G | A | het | 0.025 | ||
| rs1733676 | American | A/A | G | A | hom | 0.05 | ||
| rs2024714 | American (Caucasian) | CDH4 | T/C | C | T | het | 0.065 | |
| rs2826891 | American (Caucasian) | NCAM2 | T/C | C | T | het | 0.065 | |
| rs2032563 | American (Caucasian) | CAMTA1 | A/G | G | A | het | 0.07 | |
| rs10489436 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs11211037 | American (Caucasian) | BTBD19 | C/A | A | C | het | 0.07 | |
| rs10923673 | American (Caucasian) | G/T | T | G | het | 0.07 | ||
| rs12043001 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs4285687 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs6657655 | American (Caucasian) | LOC105373215 | T/C | C | T | het | 0.07 | |
| rs2247549 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4237774 | American (Caucasian) | LOC107984303 | A/G | G | A | het | 0.07 | |
| rs1834461 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs563384 | American (Caucasian) | TENM4 | G/A | A | G | het | 0.07 | |
| rs1470196 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs11063009 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs855137 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs2660888 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs697887 | American (Caucasian) | LINC02463 | G/A | A | G | het | 0.07 | |
| rs1340573 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs9652250 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs9513192 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs7149754 | American (Caucasian) | LOC105370656 | G/A | A | G | het | 0.07 | |
| rs10518725 | American (Caucasian) | WDR72 | A/G | G | A | het | 0.07 | |
| rs1280396 | American (Caucasian) | CGNL1 | G/A | A | G | het | 0.07 | |
| rs12446827 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs1005321 | American (Caucasian) | HS3ST3B1 | A/G | G | A | het | 0.07 | |
| rs2880540 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs8073559 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs9894254 | American (Caucasian) | SGSH | T/C | C | T | het | 0.07 | |
| rs12606250 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs2927261 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs7246865 | American (Caucasian) | MYO9B | A/G | G | A | het | 0.07 | |
| rs11687681 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs401974 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs3769583 | American (Caucasian) | TTC27 | T/C | C | T | het | 0.07 | |
| rs2901840 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs12623542 | American (Caucasian) | LINC01237 | G/T | T | G | het | 0.07 | |
| rs2866705 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs2253363 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs5754682 | American (Caucasian) | LARGE1 | T/C | C | T | het | 0.07 | |
| rs12634249 | American (Caucasian) | SUMF1 | A/C | C | A | het | 0.07 | |
| rs751481 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs922943 | American (Caucasian) | RARB | A/G | G | A | het | 0.07 | |
| rs1550765 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs10084768 | American (Caucasian) | LINC01182 | A/G | G | A | het | 0.07 | |
| rs828154 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs358256 | American (Caucasian) | GBA3 | C/T | T | C | het | 0.07 | |
| rs2660342 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs1230155 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs2553377 | American (Caucasian) | A/C | C | A | het | 0.07 | ||
| rs4461634 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs2432143 | American (Caucasian) | ITGA1 | C/T | T | C | het | 0.07 | |
| rs158807 | American (Caucasian) | G/T | T | G | het | 0.07 | ||
| rs147295 | American (Caucasian) | C/T | T | C | het | 0.07 | ||
| rs9324976 | American (Caucasian) | C/A | A | C | het | 0.07 | ||
| rs514217 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4245543 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs11153598 | American (Caucasian) | NT5DC1 | A/C | C | A | het | 0.07 | |
| rs1858897 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs2738173 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs804283 | American (Caucasian) | GATA4 | A/G | G | A | het | 0.07 | |
| rs899430 | American (Caucasian) | G/A | A | G | het | 0.07 | ||
| rs4871976 | American (Caucasian) | PHYHIP | A/G | G | A | het | 0.07 | |
| rs7825208 | American (Caucasian) | FGFR1 | G/A | A | G | het | 0.07 | |
| rs1812736 | American (Caucasian) | A/G | G | A | het | 0.07 | ||
| rs12353067 | American (Caucasian) | T/C | C | T | het | 0.07 | ||
| rs2590504 | American (Caucasian) | PPP1R26-AS1 | T/C | C | T | het | 0.08 | |
| rs10149689 | Ashkenazi Jewish | CEP128 | G/A | A | G | het | 0.085 | |
| rs12050077 | Ashkenazi Jewish | CEP128 | A/G | G | A | het | 0.085 | |
| rs2498804 | Dutch | LOC107987209 | A/C | C | A | het | 0.095 | |
| rs1468772 | American (Caucasians), Italian (Southern), French, Ashkenazi Jewish | SEMA4A | G/G | T | G | hom | 0.1 | |
| rs205990 | American (Amish) | LOC105378102 | G/G | A | G | hom | 0.1 | |
| rs519007 | German | G/G | G | G | hom | 0.1 | ||
| rs7799039 | Jordanian | LOC105375494 | A/G | G | A | het | 0.115 | |
| rs10256972 | American (Caucasian) | C7orf50 | A/A | A | A | hom | 0.13 | |
| rs2370413 | American (Caucasian) | CACNA1C | T/T | T | T | hom | 0.13 | |
| rs1834497 | American (Caucasian) | CLSTN2 | A/A | A | A | hom | 0.13 | |
| rs12129750 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs12737127 | American (Caucasian) | LOC105373220 | C/C | A | C | hom | 0.14 | |
| rs4933309 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs11218921 | American (Caucasian) | LOC341056 | C/C | T | C | hom | 0.14 | |
| rs2722222 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs2014547 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs2543356 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs7155817 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs2277509 | American (Caucasian) | CCDC88C | A/A | C | A | hom | 0.14 | |
| rs8098316 | American (Caucasian) | G/G | T | G | hom | 0.14 | ||
| rs9304496 | American (Caucasian) | KCTD1 | T/T | C | T | hom | 0.14 | |
| rs11086106 | American (Caucasian) | PGPEP1 | T/T | C | T | hom | 0.14 | |
| rs1974676 | American (Caucasian) | HPCAL1 | G/G | A | G | hom | 0.14 | |
| rs4363980 | American (Caucasian) | LOC105373714 | G/G | T | G | hom | 0.14 | |
| rs1463990 | American (Caucasian) | LOC107985988 | A/A | G | A | hom | 0.14 | |
| rs6115865 | American (Caucasian) | C20orf194 | T/T | C | T | hom | 0.14 | |
| rs3904864 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs2201186 | American (Caucasian) | LOC107986178 | A/A | G | A | hom | 0.14 | |
| rs4073968 | American (Caucasian) | LINC01258 | T/T | C | T | hom | 0.14 | |
| rs975072 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs1490813 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs6580511 | American (Caucasian) | A/A | G | A | hom | 0.14 | ||
| rs303006 | American (Caucasian) | CMAHP | G/G | A | G | hom | 0.14 | |
| rs6946852 | American (Caucasian) | T/T | C | T | hom | 0.14 | ||
| rs6991271 | American (Caucasian) | KIF13B | G/G | T | G | hom | 0.14 | |
| rs567971 | American (Caucasian) | C/C | T | C | hom | 0.14 | ||
| rs829751 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs1016013 | American (Caucasian) | G/G | A | G | hom | 0.14 | ||
| rs924584 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs8080728 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs8069437 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs8003056 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs7505612 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs793017 | American (Caucasian) | ERGIC1 | G/G | G | G | hom | 0.14 | |
| rs933664 | American (Caucasian) | GSG1L | A/A | A | A | hom | 0.14 | |
| rs10210870 | American (Caucasian) | LINC01250 | C/C | C | C | hom | 0.14 | |
| rs15606 | American (Caucasian) | LINC02032 | T/T | T | T | hom | 0.14 | |
| rs3803833 | American (Caucasian) | LINC02095 | T/T | T | T | hom | 0.14 | |
| rs337656 | American (Caucasian) | LINC02391 | C/C | C | C | hom | 0.14 | |
| rs2158860 | American (Caucasian) | LOC101927668 | A/A | A | A | hom | 0.14 | |
| rs2061450 | American (Caucasian) | LOC105372161 | G/G | G | G | hom | 0.14 | |
| rs10505391 | American (Caucasian) | LOC105375731 | C/C | C | C | hom | 0.14 | |
| rs4802234 | American (Caucasian) | LOC107985305 | T/T | T | T | hom | 0.14 | |
| rs3886917 | American (Caucasian) | LOC107986178 | C/C | C | C | hom | 0.14 | |
| rs12960908 | American (Caucasian) | LOC400655 | T/T | T | T | hom | 0.14 | |
| rs9554632 | American (Caucasian) | MIR4500HG | T/T | T | T | hom | 0.14 | |
| rs10190125 | American (Caucasian) | MYT1L | G/G | G | G | hom | 0.14 | |
| rs894558 | American (Caucasian) | NAV2 | C/C | C | C | hom | 0.14 | |
| rs9530108 | American (Caucasian) | NBEA | A/A | A | A | hom | 0.14 | |
| rs249904 | American (Caucasian) | PPP2R2B | T/T | T | T | hom | 0.14 | |
| rs4596036 | American (Caucasian) | PREX1 | G/G | G | G | hom | 0.14 | |
| rs7857137 | American (Caucasian) | PTAR1 | A/A | A | A | hom | 0.14 | |
| rs2596230 | American (Caucasian) | RYR3 | T/T | T | T | hom | 0.14 | |
| rs10055012 | American (Caucasian) | SEMA6A | T/T | T | T | hom | 0.14 | |
| rs7959761 | American (Caucasian) | BHLHE41 | T/T | T | T | hom | 0.14 | |
| rs2116538 | American (Caucasian) | THSD7B | G/G | G | G | hom | 0.14 | |
| rs524533 | American (Caucasian) | TMEM151B | C/C | C | C | hom | 0.14 | |
| rs6984496 | American (Caucasian) | XKR6 | G/G | G | G | hom | 0.14 | |
| rs4240673 | American (Caucasian) | XKR6 | T/T | T | T | hom | 0.14 | |
| rs11005328 | American (Caucasian) | ZWINT | C/C | C | C | hom | 0.14 | |
| rs4771711 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs4722094 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs346119 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs303542 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs277432 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs2679234 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs2604294 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs2331101 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs1822590 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs1581035 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs1411552 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs1368774 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs13125710 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs12121466 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs1189843 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs11610554 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs11601702 | American (Caucasian) | A/A | A | A | hom | 0.14 | ||
| rs10863373 | American (Caucasian) | G/G | G | G | hom | 0.14 | ||
| rs10498342 | American (Caucasian) | C/C | C | C | hom | 0.14 | ||
| rs10229977 | American (Caucasian) | T/T | T | T | hom | 0.14 | ||
| rs432203 | American (Caucasian) | TGFA | C/C | C | C | hom | 0.16 | |
| rs4646 | Italian (Salerno) | CYP19A1 | A/A | A | A | hom | 0.18 | |
| rs28933981 | Danish | TTR | C/C | C | C | hom | 0.19 | |
| rs3906146 | American (Caucasian) | LMX1B | C/C | C | C | hom | 0.2 | |
| rs4541274 | American (Caucasian) | CTNNA2 | C/T | T | C | het | 0.205 | |
| rs723525 | American (Caucasian) | CTNNA2 | G/A | A | G | het | 0.205 | |
| rs978739 | Italian (Southern) | TAS2R16 | T/T | T | T | hom | 0.24 | |
| rs3851179 | multiple | PICALM | T/T | T | T | hom | 0.34 | |
| rs7656234 | American (Caucasian) | SLC4A4 | T/T | C | T | hom | 0.37 | |
| rs1860242 | American (Caucasian) | CTNND2 | G/G | A | G | hom | 0.41 |
Beneficial Genotypes:
rs7656234 (SLC4A4): This SNP is associated with a positive influence on health, with a weight of 0.37. The SLC4A4 gene encodes a sodium bicarbonate cotransporter involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. More info on rs7656234.
rs1860242 (CTNND2): This SNP is associated with a positive influence on health, with a weight of 0.41. The CTNND2 gene encodes an adhesive junction-associated protein implicated in brain and eye development and cancer formation. More info on rs1860242.
Detrimental Genotypes:
rs2277509 (CCDC88C): This SNP is associated with a negative influence on health, with a weight of 0.14. The CCDC88C gene is involved in the regulation of the Wnt signaling pathway and mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus. More info on rs2277509.
rs1468772 (SEMA4A): This SNP is associated with a negative influence on health, with a weight of 0.1. The SEMA4A gene is involved in the immune response and mutations in this gene are associated with various immune-related conditions. More info on rs1468772.
The interaction between beneficial and detrimental genotypes can influence overall health outcomes. For instance, the presence of beneficial genotypes like rs7656234 (SLC4A4) and rs1860242 (CTNND2) may mitigate some of the risks posed by detrimental genotypes such as rs2277509 (CCDC88C) and rs1468772 (SEMA4A). However, the exact nature of these interactions would require further study.
Longevity Related Risks:
rs2277509 (CCDC88C): This SNP is associated with a risk of congenital hydrocephalus, which can impact overall longevity due to complications arising from the condition.
rs1468772 (SEMA4A): This SNP is associated with immune-related conditions, which can affect longevity by increasing susceptibility to infections and autoimmune diseases.
General Risks:
rs2277509 (CCDC88C): This SNP is associated with a risk of congenital hydrocephalus, which can lead to developmental delays and neurological issues.
rs1468772 (SEMA4A): This SNP is associated with immune-related conditions, which can lead to chronic inflammation and other health issues.
For rs2277509 (CCDC88C): Regular monitoring and early intervention for signs of hydrocephalus can help manage the condition. Surgical options like shunt placement can alleviate symptoms and improve quality of life.
For rs1468772 (SEMA4A): Maintaining a healthy immune system through a balanced diet, regular exercise, and avoiding known allergens can help mitigate risks. Regular check-ups with an immunologist can also be beneficial.
The presence of beneficial genotypes like rs7656234 (SLC4A4) and rs1860242 (CTNND2) suggests a potential for better regulation of pH balance and cellular adhesion, which can contribute to overall health and longevity. These genotypes may offer some protective effects against the detrimental impacts of other SNPs.
Plenty of drugs are frequently prescribed at an older age. Moreover, some drugs are known to have geroprotective action (e.g. statins, metformin, rapamycin, etc.). Drug metabolism to a large extent depends on a person’s genetic polymorphisms, affecting the activity of xenobiotics-transforming enzymes. So it’s a common situation when individual dose correction is needed, or even another drug has to be taken in order to avoid adverse effects. Longevity-drugs report is mainly based on data from PharmGKB database ( https://www.pharmgkb.org/ ) and DrugAge.
In the table you can find data about your genome’s gene variants, associated with a changed response to the drugs.
| # | Variant/Haplotypes | Drug(s) | Phenotype Category | Significance | Sentence | Allele Of Frequency In Cases | Allele Of Frequency In Controls | Ratio Stat Type | Effect |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs2284018 | lithium | Efficacy | yes | Genotype TT is associated with decreased response to lithium in people with Bipolar Disorder as compared to genotypes CC + CT. | OR | 9.091 | ||
| 2 | rs7316769 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 7.692 | ||
| 3 | rs10771999 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 7.692 | ||
| 4 | rs5441 | sertraline | Efficacy | yes | Genotype GG is associated with increased response to sertraline in people with Depressive Disorder, Major as compared to genotypes AA + AG. | G | OR | 5.9 | |
| 5 | rs7306991 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 5.882 | ||
| 6 | rs10771997 | duloxetine | Efficacy | yes | Allele T is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 5.882 | ||
| 7 | rs10771998 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 5.882 | ||
| 8 | rs12595802 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 5.556 | ||
| 9 | rs12630569 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 5.556 | ||
| 10 | rs4513095 | sofosbuvir | Efficacy | yes | Allele A is associated with decreased response to sofosbuvir in people with Hepatitis C, Chronic as compared to allele C. | A | A | OR | 5.54 |
| 11 | rs7563206 | methotrexate | Efficacy | yes | Genotypes CT + TT is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype CC. | C | C | OR | 5.0 |
| 12 | rs7787082 | clozapine | Efficacy | yes | Allele G is associated with decreased response to clozapine in people with Schizophrenia as compared to allele A. | A | OR | 4.87 | |
| 13 | rs3087403 | cisplatin | Efficacy | yes | Genotypes CT + TT are associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype CC. | T | OR | 4.44 | |
| 14 | rs1056827 | risperidone | Efficacy | no | Allele A is associated with decreased response to risperidone in people with Schizophrenia as compared to allele C. | A | A | OR | 4.37 |
| 15 | rs243865 | ulinastatin | Efficacy | yes | Allele T is associated with decreased response to ulinastatin in people with Pancreatitis as compared to allele C. | T | T | OR | 4.121 |
| 16 | rs622342 | metformin | Efficacy | yes | Genotypes AC + CC is associated with decreased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype AA. | A | OR | 4.1 | |
| 17 | rs11591741 | ustekinumab | Efficacy | yes | Genotypes CC + CG is associated with increased response to ustekinumab in people with Psoriasis as compared to genotype GG. | OR | 33.333 | ||
| 18 | rs1801133 | fluorouracil | Efficacy | yes | Genotypes AA + AG is associated with increased response to fluorouracil in people with Colorectal Neoplasms as compared to genotype GG. | A | OR | 3.8 | |
| 19 | rs4437856 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.704 | ||
| 20 | rs2419128 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.704 | ||
| 21 | rs12094644 | duloxetine | Efficacy | yes | Allele T is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 3.704 | ||
| 22 | rs1883112 | idarubicin | Efficacy | yes | Genotype AA is associated with increased response to idarubicin in people with Leukemia, Myeloid, Acute as compared to genotype GG. | A | OR | 3.7 | |
| 23 | rs4633 | risperidone | Efficacy | no | Allele T is associated with decreased response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 3.56 |
| 24 | rs10007051 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.448 | ||
| 25 | rs11933890 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 3.333 | ||
| 26 | rs62319299 | duloxetine | Efficacy | yes | Allele A is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.333 | ||
| 27 | rs56229625 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.333 | ||
| 28 | rs55881666 | duloxetine | Efficacy | yes | Allele C is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 3.333 | ||
| 29 | rs4639250 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.333 | ||
| 30 | rs12657120 | duloxetine | Efficacy | yes | Allele G is associated with decreased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 3.226 | ||
| 31 | rs10012 | risperidone | Efficacy | no | Allele C is associated with decreased response to risperidone in people with Schizophrenia as compared to allele G. | C | C | OR | 3.16 |
| 32 | rs2270007 | citalopram | Efficacy | yes | Genotypes CC + CG are associated with decreased response to citalopram in people with Depressive Disorder, Major as compared to genotype GG. | C | C | OR | 2.93 |
| 33 | rs8636 | amisulpride | Efficacy | yes | Genotype CT is associated with increased response to amisulpride in people with Schizophrenia as compared to genotypes CC + TT. | C | C | OR | 2.91 |
| 34 | rs6498169 | glatiramer acetate | Efficacy | yes | Allele A is associated with increased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.86 |
| 35 | rs2284017 | lithium | Efficacy | not stated | Allele C is associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | OR | 2.857 | ||
| 36 | rs316019 | metformin | Efficacy | yes | Genotypes AA + AC is associated with increased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype CC. | A | A | OR | 2.857 |
| 37 | rs1695 | cyclophosphamide | Efficacy | no | Genotypes AG + GG is associated with decreased response to cyclophosphamide in people with Lupus Nephritis as compared to genotype AA. | G | G | OR | 2.8 |
| 38 | rs3749442 | cannabidiol | Efficacy | yes | Genotypes AA + AG are associated with decreased response to cannabidiol in people with Epilepsy as compared to genotype GG. | OR | 2.778 | ||
| 39 | rs2114358 | glatiramer acetate | Efficacy | yes | Allele A is associated with increased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.77 |
| 40 | rs11869731 | lithium | Efficacy | yes | Genotype CC is associated with increased response to lithium in people with Bipolar Disorder as compared to genotypes CG + GG. | C | C | OR | 2.39 |
| 41 | rs4818 | risperidone | Efficacy | no | Allele G is associated with increased response to risperidone in people with Schizophrenia as compared to allele C. | C | C | OR | 2.381 |
| 42 | rs3747178 | ethosuximide | Efficacy | yes | Allele T is associated with decreased clinical benefit to ethosuximide in children with Epilepsy as compared to allele C. | T | T | OR | 2.38 |
| 43 | rs1800469 | glatiramer acetate | Efficacy | yes | Allele A is associated with decreased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele G. | A | A | OR | 2.326 |
| 44 | rs165599 | bupropion | Efficacy | yes | Genotypes AA + AG are associated with increased response to bupropion in smokers as compared to genotype GG. | A | OR | 2.21 | |
| 45 | rs35068180 | pravastatin | Efficacy | yes | Genotypes A/del + AA are associated with increased response to pravastatin in men with Coronary Artery Disease. | OR | 2.174 | ||
| 46 | rs1801058 | metoprolol | Efficacy | yes | Genotype CT is associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype CC. | HR | 2.174 | ||
| 47 | rs2631372 | imatinib | Efficacy | yes | Genotypes CG + GG are associated with increased response to imatinib in people with Gastrointestinal Stromal Tumors as compared to genotype CC. | HR | 2.174 | ||
| 48 | rs680244 | Drugs used in nicotine dependence | Other | yes | Allele T is associated with increased response to Drugs used in nicotine dependence in people with Tobacco Use Disorder. | HR | 2.083 | ||
| 49 | rs616147 | creatine | Efficacy | yes | Genotypes AA + AG are associated with increased response to creatine in people with Amyotrophic Lateral Sclerosis as compared to genotype GG. | A | HR | 2.083 | |
| 50 | rs1495741 | iguratimod | Efficacy | yes | Genotypes AG + GG is associated with decreased clinical benefit to iguratimod in people with Arthritis, Rheumatoid as compared to genotype AA. | G | G | OR | 2.008 |
| 51 | rs1012335 | glatiramer acetate | Efficacy | yes | Allele G is associated with decreased response to glatiramer acetate in people with Multiple Sclerosis as compared to allele C. | G | G | OR | 13.889 |
| 52 | rs11042725 | paroxetine | Efficacy | yes | Genotype CC is associated with decreased response to paroxetine in people with Depressive Disorder, Major as compared to genotypes AA + AC. | OR | 13.333 | ||
| 53 | rs9923231 | acenocoumarol | Dosage | yes | Genotype TT is associated with decreased dose of acenocoumarol as compared to genotypes CC + CT. | T | OR | 11.6 | |
| 54 | rs1329428 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.961 | ||
| 55 | rs3763980 | methotrexate | Efficacy | yes | Allele A is associated with decreased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to allele T. | OR | 1.887 | ||
| 56 | rs10033900 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.887 | ||
| 57 | rs3781719 | botulinum toxin type a | Efficacy | yes | Allele G is associated with decreased response to botulinum toxin type a in women with Migraine NOS as compared to allele A. | G | G | OR | 1.88 |
| 58 | rs2631370 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele T. | C | OR | 1.87 | |
| 59 | rs2010963 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | C | OR | 1.852 | |
| 60 | rs2804402 | methotrexate | Toxicity | no | Allele A is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | G | HR | 1.79 | |
| 61 | rs1800544 | methylphenidate | Efficacy | no | Allele G is associated with decreased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 1.786 | ||
| 62 | rs6990851 | anastrozole | Efficacy | yes | Allele G is associated with increased response to anastrozole in women with Breast Neoplasms as compared to allele A. | HR | 1.786 | ||
| 63 | rs8109525 | bupropion | Efficacy | yes | Genotype GG is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes AA + AG. | G | OR | 1.78 | |
| 64 | rs1410996 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 1.754 | ||
| 65 | rs2032582 | imatinib | Efficacy | no | Allele T is not associated with response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to allele A. | G | A | OR | 1.754 |
| 66 | rs2032582 | imatinib | Efficacy | no | Allele T is not associated with response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to allele A. | G | A | OR | 1.754 |
| 67 | rs7574865 | adalimumab | Efficacy | no | Allele T is not associated with response to adalimumab in people with Arthritis, Rheumatoid as compared to allele G. | T | OR | 1.724 | |
| 68 | rs628031 | imatinib | Efficacy | yes | Genotypes AA + AG is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype GG. | OR | 1.724 | ||
| 69 | rs2229437 | benazepril | Efficacy | yes | Genotypes GG + GT are associated with decreased response to benazepril in people with Hypertension as compared to genotype TT. | T | OR | 1.667 | |
| 70 | rs10737680 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele C. | OR | 1.613 | ||
| 71 | rs12231740 | methotrexate | Efficacy | yes | Allele T is associated with decreased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to allele C. | OR | 1.587 | ||
| 72 | rs20455 | pravastatin | Efficacy | yes | Genotypes AG + GG are associated with increased response to pravastatin in people with Myocardial Infarction as compared to genotype AA. | HR | 1.587 | ||
| 73 | rs2236259 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | T | OR | 1.587 | |
| 74 | rs3204953 | cisplatin | Efficacy | no | Genotypes CT + TT are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype CC. | T | OR | 1.56 | |
| 75 | rs3212986 | cisplatin | Efficacy | yes | Allele A is associated with decreased response to cisplatin in women with Ovarian Neoplasms as compared to allele C. | A | OR | 1.53 | |
| 76 | rs249429 | metformin | Efficacy | no | Allele T is not associated with response to metformin in people with Diabetes Mellitus as compared to allele C. | C | T | OR | 1.471 |
| 77 | rs3852209 | nicotine | Efficacy | yes | Genotypes CT + TT are associated with increased response to nicotine in people with Tobacco Use Disorder as compared to genotype CC. | T | OR | 1.46 | |
| 78 | rs7905446 | nortriptyline | Efficacy | no | Genotype TT is not associated with response to nortriptyline in people with Depression as compared to genotypes GG + GT. | OR | 1.441 | ||
| 79 | rs2494732 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 1.414 |
| 80 | rs274717 | gemcitabine | Efficacy | no | Genotypes AG + GG are associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotype AA. | HR | 1.408 | ||
| 81 | rs2960306 | metoprolol | Efficacy | no | Genotype TT is not associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype GG. | HR | 1.389 | ||
| 82 | rs2811332 | lithium | Efficacy | no | Allele C is not associated with response to lithium in people with Bipolar Disorder as compared to allele G. | C | C | OR | 1.36 |
| 83 | rs2236256 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele A. | A | OR | 1.35 | |
| 84 | rs3736544 | lithium | Efficacy | no | Allele A is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele G. | A | OR | 1.333 | |
| 85 | rs2082940 | pioglitazone | Efficacy | no | Genotype CC are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotypes CT + TT. | C | T | OR | 1.303 |
| 86 | rs16969968 | nicotine | Other | no | Allele A is not associated with exposure to nicotine in men as compared to allele G. | A | OR | 1.3 | |
| 87 | rs2306283 | atorvastatin | Efficacy | yes | Genotype AA is associated with increased response to atorvastatin in people with Hypercholesterolemia as compared to genotypes AG + GG. | G | OR | 1.29 | |
| 88 | rs8065082 | metformin | Efficacy | yes | Genotypes CT + TT is associated with increased response to metformin in people with Glucose Intolerance as compared to genotype CC. | HR | 1.282 | ||
| 89 | rs1800797 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele A. | RR | 1.282 | ||
| 90 | rs1800796 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele C. | RR | 1.282 | ||
| 91 | rs1800795 | peginterferon alfa-2a | Efficacy | yes | Allele G is associated with decreased response to peginterferon alfa-2a in people with Hepatitis C, Chronic as compared to allele C. | RR | 1.282 | ||
| 92 | rs6313 | risperidone | Efficacy | no | Allele A is not associated with response to risperidone in people with Schizophrenia as compared to allele G. | A | A | OR | 1.274 |
| 93 | rs699947 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele A. | C | OR | 1.27 | |
| 94 | rs868755 | imatinib | Dosage | no | Allele T is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | T | OR | 1.266 | |
| 95 | rs1063538 | pioglitazone | Efficacy | no | Genotypes CC + CT are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype TT. | C | T | OR | 1.255 |
| 96 | rs1800532 | venlafaxine | Efficacy | no | Allele G is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele T. | OR | 1.25 | ||
| 97 | rs12205732 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | A | OR | 1.242 | |
| 98 | rs762551 | imatinib | Dosage | yes | Genotype CC is associated with decreased dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to genotypes AA + AC. | C | OR | 1.235 | |
| 99 | rs2295553 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 1.235 | ||
| 100 | rs2740574 | amlodipine | Efficacy | no | Genotypes CT + TT are not associated with response to amlodipine in people with Hypertension as compared to genotype CC. | HR | 1.235 | ||
| 101 | rs6280 | clozapine | Efficacy | not stated | Allele T is not associated with response to clozapine in people with Schizophrenia as compared to allele C. | OR | 1.22 | ||
| 102 | rs17035723 | acamprosate | Efficacy | no | Allele T is not associated with response to acamprosate in people with Alcoholism as compared to allele C. | HR | 1.22 | ||
| 103 | rs266729 | pioglitazone | Efficacy | no | Genotype CC are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotypes CG + GG. | G | C | OR | 1.219 |
| 104 | rs3774261 | pioglitazone | Efficacy | no | Genotypes AG + GG are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype AA. | G | A | OR | 1.209 |
| 105 | rs1329424 | ranibizumab | Efficacy | no | Allele G is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 1.205 | ||
| 106 | rs2278749 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 1.18 | |
| 107 | rs11212617 | metformin | Efficacy | no | Allele C is not associated with response to metformin in people with Diabetes Mellitus, Type 2 as compared to allele A. | OR | 1.163 | ||
| 108 | rs9828223 | adalimumab | Efficacy | yes | Allele T is associated with decreased response to adalimumab in people with Crohn Disease as compared to allele C. | T | OR | 1.16 | |
| 109 | rs2231142 | sulfasalazine | Other | no | Allele T is not associated with discontinuation of sulfasalazine in people with Arthritis, Rheumatoid as compared to allele G. | T | HR | 1.15 | |
| 110 | rs1042522 | oxaliplatin | Efficacy | yes | Genotypes CG + GG is associated with decreased response to oxaliplatin in people with Colorectal Neoplasms as compared to genotype CC. | G | HR | 1.136 | |
| 111 | rs683369 | imatinib | Dosage | no | Allele G is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele C. | G | OR | 1.136 | |
| 112 | rs3821799 | pioglitazone | Efficacy | no | Genotypes CT + TT are not associated with response to pioglitazone in people with Diabetes Mellitus as compared to genotype CC. | C | T | OR | 1.131 |
| 113 | rs2244500 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | OR | 1.124 | ||
| 114 | rs6506569 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 1.124 | ||
| 115 | rs293983 | belimumab | Efficacy | no | Allele T is not associated with response to belimumab in people with Lupus erythematosus as compared to allele C. | OR | 1.111 | ||
| 116 | rs1390913 | lithium | Efficacy | no | Allele A is not associated with response to lithium in people with Bipolar Disorder as compared to allele G. | A | A | OR | 1.11 |
| 117 | rs6495307 | nicotine | Other | no | Allele T is not associated with exposure to nicotine in men as compared to allele C. | T | OR | 1.1 | |
| 118 | rs6347 | methadone | Dosage | no | Allele C is not associated with dose of methadone in people with Heroin Dependence as compared to allele T. | C | OR | 1.09 | |
| 119 | rs2013169 | methylphenidate | Efficacy | no | Allele T is associated with decreased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 1.087 | ||
| 120 | rs662 | clopidogrel | Efficacy | no | Genotypes CC + CT is not associated with response to clopidogrel in people with Acute coronary syndrome as compared to genotype TT. | T | HR | 1.087 | |
| 121 | rs3808627 | heroin | Dosage | no | Allele T is not associated with dose of heroin in people with Heroin Dependence as compared to allele C. | T | OR | 1.082 | |
| 122 | rs1947274 | methylphenidate | Efficacy | no | Allele A is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 1.053 | ||
| 123 | rs6902403 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | T | OR | 1.053 | |
| 124 | rs3212964 | cisplatin | Efficacy | no | Allele T is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele C. | T | OR | 1.05 | |
| 125 | rs4483927 | risperidone | Efficacy | no | Allele G is not associated with response to risperidone in people with Schizophrenia as compared to allele T. | G | G | OR | 1.033 |
| 126 | rs2071559 | imatinib | Dosage | no | Allele A is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | A | OR | 1.02 | |
| 127 | rs3393 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | C | HR | 1.01 | |
| 128 | rs11568817 | venlafaxine | Efficacy | no | Allele C is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele A. | OR | 1.01 | ||
| 129 | rs2230199 | eculizumab | Efficacy | no | Genotypes CC + CG is not associated with response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype GG. | C | OR | 1.0 | |
| 130 | rs5836788 | methotrexate | Efficacy | no | Allele del is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 1.0 | ||
| 131 | rs3827020 | nicotine | Other | no | Allele C is not associated with exposure to nicotine in men as compared to allele T. | C | OR | 1.0 | |
| 132 | rs2072660 | varenicline | Efficacy | no | Genotypes CT + TT are not associated with response to varenicline in people with Tobacco Use Disorder as compared to genotype CC. | OR | 0.99 | ||
| 133 | rs1051740 | carbamazepine | Efficacy | no | Genotype TT is not associated with resistance to carbamazepine in people with Epilepsy as compared to genotypes CC + CT. | C | T | OR | 0.98 |
| 134 | rs1024323 | metoprolol | Efficacy | no | Genotype CC is not associated with decreased response to metoprolol in women with hypertensive nephrosclerosis as compared to genotype TT. | HR | 0.98 | ||
| 135 | rs1805054 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 0.973 |
| 136 | rs699517 | methotrexate | Efficacy | no | Allele T is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.971 | ||
| 137 | rs9567746 | venlafaxine | Efficacy | no | Allele A is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.962 | ||
| 138 | rs3212961 | cisplatin | Efficacy | no | Allele A is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele G. | A | OR | 0.962 | |
| 139 | rs743572 | abiraterone | Efficacy | no | Genotypes AG + GG are not associated with response to abiraterone in men with Prostatic Neoplasms as compared to genotype AA. | G | HR | 0.96 | |
| 140 | rs6912029 | heroin | Dosage | no | Allele T is not associated with dose of heroin in people with Heroin Dependence as compared to allele G. | T | OR | 0.955 | |
| 141 | rs3394 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | T | HR | 0.952 | |
| 142 | rs2234922 | carbamazepine | Efficacy | no | Genotype AA is not associated with resistance to carbamazepine in people with Epilepsy as compared to genotypes AG + GG. | A | G | OR | 0.952 |
| 143 | rs6296 | venlafaxine | Efficacy | no | Allele C is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.952 | ||
| 144 | rs6935207 | imatinib | Dosage | no | Allele A is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | A | OR | 0.94 | |
| 145 | rs6551665 | methylphenidate | Efficacy | no | Allele A is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele G. | OR | 0.935 | ||
| 146 | rs1049305 | cisplatin | Efficacy | no | Genotypes CC + CG are not associated with response to cisplatin in people with Mesothelioma as compared to genotype GG. | HR | 0.926 | ||
| 147 | rs228666 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.92 | |
| 148 | rs2236257 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele G. | C | OR | 0.92 | |
| 149 | rs615470 | nicotine | Other | no | Allele T is not associated with exposure to nicotine in men as compared to allele C. | T | OR | 0.909 | |
| 150 | rs228642 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.901 | |
| 151 | rs2279287 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 0.901 | |
| 152 | rs2631367 | imatinib | Dosage | no | Allele C is not associated with dose of imatinib in people with Gastrointestinal Stromal Tumors as compared to allele G. | G | OR | 0.9 | |
| 153 | rs12666409 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele T. | A | OR | 0.896 | |
| 154 | rs5320 | methadone | Dosage | no | Allele A is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | A | OR | 0.895 | |
| 155 | rs130058 | venlafaxine | Efficacy | no | Allele A is not associated with response to venlafaxine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.893 | ||
| 156 | rs4810083 | metformin | Efficacy | no | Allele T is not associated with response to metformin in people with Diabetes Mellitus as compared to allele C. | C | T | OR | 0.89 |
| 157 | rs1136287 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.885 | ||
| 158 | rs4343 | sertraline | Efficacy | no | Genotype GG is not associated with response to sertraline in people with Depressive Disorder. | G | G | OR | 0.885 |
| 159 | rs2640909 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele T. | C | OR | 0.88 | |
| 160 | rs228729 | lithium | Efficacy | no | Allele T is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele C. | T | OR | 0.877 | |
| 161 | rs1045280 | nicotine | Efficacy | no | Allele C is not associated with response to nicotine in people with Tobacco Use Disorder as compared to allele T. | C | OR | 0.877 | |
| 162 | rs2236196 | varenicline | Efficacy | no | Genotypes AA + AG is not associated with response to varenicline in people with Tobacco Use Disorder as compared to genotype GG. | OR | 0.87 | ||
| 163 | rs9322453 | heroin | Dosage | no | Allele C is not associated with dose of heroin in people with Heroin Dependence as compared to allele G. | C | OR | 0.865 | |
| 164 | rs129915 | methadone | Dosage | no | Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele A. | G | OR | 0.861 | |
| 165 | rs27072 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele C. | T | OR | 0.858 | |
| 166 | rs6064463 | methotrexate | Efficacy | no | Allele C is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | OR | 0.855 | ||
| 167 | rs735482 | cisplatin | Efficacy | no | Allele C is not associated with response to cisplatin in women with Ovarian Neoplasms as compared to allele A. | C | OR | 0.85 | |
| 168 | rs10011796 | allopurinol | Efficacy | no | Genotypes CT + TT are not associated with response to allopurinol in people with Gout as compared to genotype CC. | C | T | OR | 0.85 |
| 169 | rs12529 | abiraterone | Efficacy | no | Genotypes CC + CG are not associated with response to abiraterone in men with Prostatic Neoplasms as compared to genotype GG. | C | HR | 0.847 | |
| 170 | rs1800497 | risperidone | Efficacy | no | Allele A is not associated with response to risperidone in people with Schizophrenia as compared to allele G. | A | A | OR | 0.845 |
| 171 | rs4982133 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.84 | ||
| 172 | rs316009 | metformin | Efficacy | yes | Genotype TT is associated with increased response to metformin in people with Diabetes Mellitus as compared to genotypes CC + CT. | OR | 0.826 | ||
| 173 | rs1176713 | risperidone | Efficacy | no | Allele G is not associated with response to risperidone in people with Schizophrenia as compared to allele A. | G | G | OR | 0.819 |
| 174 | rs3842727 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele G. | G | OR | 0.807 | |
| 175 | rs12979860 | peginterferon alfa-2b | Efficacy | no | Genotype CC is not associated with increased response to peginterferon alfa-2b in people with Hepatitis B, Chronic as compared to genotype CT. | OR | 0.806 | ||
| 176 | rs12693402 | lithium | Efficacy | no | Allele C is not associated with response to lithium in people with Bipolar Disorder as compared to allele T. | C | C | OR | 0.8 |
| 177 | rs4680 | levodopa | Dosage | no | Genotype AA is not associated with dose of levodopa in people with Parkinson Disease as compared to genotype GG. | A | OR | 0.8 | |
| 178 | rs699946 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.8 | ||
| 179 | rs800292 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.794 | ||
| 180 | rs5888 | ranibizumab | Efficacy | no | Allele A is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele G. | OR | 0.781 | ||
| 181 | rs2650972 | methotrexate | Efficacy | no | Allele T is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.781 | ||
| 182 | rs10770140 | methadone | Dosage | no | Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele C. | C | OR | 0.766 | |
| 183 | rs2160734 | acamprosate | Efficacy | no | Allele C is not associated with response to acamprosate in people with Alcoholism as compared to allele T. | C | C | HR | 0.763 |
| 184 | rs3761372 | methylphenidate | Efficacy | no | Allele T is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.763 | ||
| 185 | rs3787429 | risperidone | Efficacy | no | Allele T is not associated with response to risperidone in people with Schizophrenia as compared to allele C. | T | T | OR | 0.756 |
| 186 | rs34897046 | lithium | Efficacy | no | Allele C is not associated with increased response to lithium in people with Bipolar Disorder as compared to allele G. | OR | 0.746 | ||
| 187 | rs162040 | methotrexate | Efficacy | no | Allele A is not associated with response to methotrexate in people with Arthritis, Rheumatoid as compared to allele C. | OR | 0.741 | ||
| 188 | rs10770141 | methadone | Dosage | no | Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele A. | A | OR | 0.73 | |
| 189 | rs3792452 | methylphenidate | Efficacy | not stated | Genotype CT is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype CC. | OR | 0.714 | ||
| 190 | rs929740 | methylphenidate | Efficacy | no | Allele G is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.714 | ||
| 191 | rs2236258 | methadone | Efficacy | no | Allele C is not associated with response to methadone in people with Heroin Dependence as compared to allele T. | C | OR | 0.714 | |
| 192 | rs6973474 | buprenorphine | Efficacy | yes | Allele T is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.712 | ||
| 193 | rs4291 | sertraline | Efficacy | no | Genotype TT is not associated with response to sertraline in people with Depressive Disorder. | T | T | OR | 0.709 |
| 194 | rs3745274 | efavirenz | Efficacy | yes | Genotypes GT + TT are associated with decreased resistance to efavirenz in people with HIV Infections as compared to genotype GG. | T | T | OR | 0.7 |
| 195 | rs13169373 | buprenorphine | Efficacy | yes | Allele T is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.696 | ||
| 196 | rs12943590 | metformin | Efficacy | yes | Genotypes AA + AG is associated with increased response to metformin in people with Diabetes Mellitus, Type 2 as compared to genotype GG. | A | A | OR | 0.68 |
| 197 | rs274713 | gemcitabine | Efficacy | yes | Genotype GG is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes GT + TT. | HR | 0.671 | ||
| 198 | rs465646 | cisplatin | Efficacy | no | Genotypes AG + GG are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype AA. | G | OR | 0.667 | |
| 199 | rs1799836 | levodopa | Dosage | no | Genotype TT is not associated with dose of levodopa in women with Parkinson Disease as compared to genotype CC. | T | OR | 0.667 | |
| 200 | rs9032 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.658 | ||
| 201 | rs28362731 | cisplatin | Efficacy | no | Genotype AG is not associated with response to cisplatin in people with Mesothelioma as compared to genotype GG. | HR | 0.641 | ||
| 202 | rs1061170 | photodynamic therapy | Efficacy | no | Genotype TT is not associated with response to photodynamic therapy in people with Macular Degeneration as compared to genotype CC. | C | OR | 0.637 | |
| 203 | rs4627790 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.629 | ||
| 204 | rs35661809 | salbutamol | Efficacy | yes | Allele G is associated with increased response to salbutamol in children with as compared to allele A. | OR | 0.629 | ||
| 205 | rs3803300 | risperidone | Efficacy | no | Allele C is not associated with response to risperidone in people with Schizophrenia as compared to allele T. | C | C | OR | 0.628 |
| 206 | rs610604 | ustekinumab | Efficacy | no | Genotype GG is not associated with response to ustekinumab in people with Psoriasis as compared to genotype TT. | G | OR | 0.625 | |
| 207 | rs12248560 | clopidogrel | Efficacy | no | Genotypes CT + TT is not associated with response to clopidogrel in people with Coronary Artery Disease as compared to genotype CC. | T | OR | 0.62 | |
| 208 | rs11559290 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.617 | ||
| 209 | rs3212980 | cisplatin | Efficacy | no | Genotype GT is associated with increased response to cisplatin in women with Ovarian Neoplasms as compared to genotype TT. | G | OR | 0.61 | |
| 210 | rs73598374 | methotrexate | Toxicity | no | Allele C is not associated with discontinuation of methotrexate in people with Arthritis, Rheumatoid as compared to allele T. | T | HR | 0.61 | |
| 211 | rs4562 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.606 | ||
| 212 | rs2799018 | methylphenidate | Efficacy | no | Allele T is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.599 | ||
| 213 | rs2242446 | venlafaxine | Efficacy | yes | Genotype CC is associated with increased response to venlafaxine in people with Depressive Disorder, Major as compared to genotypes CT + TT. | C | OR | 0.599 | |
| 214 | rs17834628 | salbutamol | Efficacy | yes | Allele A is associated with increased response to salbutamol in children with as compared to allele G. | OR | 0.599 | ||
| 215 | rs678849 | buprenorphine | Efficacy | yes | Genotype CC is associated with decreased response to buprenorphine in people with Opioid-Related Disorders as compared to genotypes CT + TT. | RR | 0.592 | ||
| 216 | rs45445694 | fluorouracil | Efficacy | yes | Genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2 is associated with decreased response to fluorouracil in people with Colorectal Neoplasms. | HR | 0.592 | ||
| 217 | rs11280056 | fluorouracil | Efficacy | yes | Genotype TTAAAGTTA/del is associated with decreased response to fluorouracil in people with Colorectal Neoplasms as compared to genotype del/del. | HR | 0.592 | ||
| 218 | rs4358872 | methadone | Dosage | no | Genotype GG is associated with decreased dose of methadone in people with Heroin Dependence as compared to genotypes GT + TT. | OR | 0.59 | ||
| 219 | rs1045642 | sunitinib | Efficacy | yes | Genotype AA is associated with decreased response to sunitinib in people with Carcinoma, Renal Cell as compared to genotypes AG + GG. | A | HR | 0.588 | |
| 220 | rs1801274 | cetuximab | Efficacy | yes | Genotype GG is associated with increased response to cetuximab in people with Head and Neck Neoplasms as compared to genotypes AA + AG. | A | HR | 0.585 | |
| 221 | rs581111 | buprenorphine | Efficacy | yes | Genotypes AA + AG is associated with decreased response to buprenorphine in women with Opioid-Related Disorders as compared to genotype GG. | RR | 0.581 | ||
| 222 | rs4805162 | methylphenidate | Efficacy | no | Allele G is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.581 | ||
| 223 | rs5569 | methylphenidate | Efficacy | yes | Genotype GG is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes AA + AG. | OR | 0.578 | ||
| 224 | rs7118900 | methadone | Dosage | no | Genotypes AA + AG are associated with decreased dose of methadone in people with Heroin Dependence as compared to genotype GG. | OR | 0.57 | ||
| 225 | rs2336219 | cisplatin | Efficacy | no | Genotypes AG + GG are associated with increased response to cisplatin in women with Ovarian Neoplasms as compared to genotype AA. | A | OR | 0.56 | |
| 226 | rs529520 | buprenorphine | Efficacy | yes | Genotype AA is associated with decreased response to buprenorphine in women with Opioid-Related Disorders as compared to genotype CC. | RR | 0.556 | ||
| 227 | rs13120400 | methotrexate | Efficacy | yes | Genotype CC is associated with increased response to methotrexate in people with Psoriasis as compared to genotypes CT + TT. | OR | 0.556 | ||
| 228 | rs3810818 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.552 | ||
| 229 | rs675026 | methadone | Efficacy | no | Allele G is not associated with response to methadone in people with Heroin Dependence as compared to allele A. | A | OR | 0.552 | |
| 230 | rs7719775 | platinum | Efficacy | no | Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype GG. | OR | 0.549 | ||
| 231 | rs756770 | buprenorphine | Efficacy | yes | Allele A is associated with increased response to buprenorphine in people with Opioid-Related Disorders as compared to allele C. | OR | 0.538 | ||
| 232 | rs1044457 | gemcitabine | Efficacy | yes | Genotype CC is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes CT + TT. | HR | 0.526 | ||
| 233 | rs429358 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.526 | ||
| 234 | rs2153628 | indomethacin | Efficacy | yes | Allele G is associated with increased response to indomethacin as compared to allele A. | OR | 0.521 | ||
| 235 | rs2279343 | bupropion | Efficacy | yes | Genotype AA is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes AG + GG. | A | G | OR | 0.521 |
| 236 | rs6269 | quetiapine | Efficacy | yes | Allele A is associated with decreased response to quetiapine in people with Schizophrenia as compared to allele G. | OR | 0.516 | ||
| 237 | rs35687416 | gemcitabine | Efficacy | yes | Genotype GG is associated with increased response to gemcitabine in people with Pancreatic Neoplasms as compared to genotypes GT + TT. | HR | 0.515 | ||
| 238 | rs3087386 | cisplatin | Efficacy | no | Genotypes AA + AG are not associated with increased response to cisplatin in people with Osteosarcoma as compared to genotype GG. | A | OR | 0.51 | |
| 239 | rs1128503 | sunitinib | Efficacy | no | Genotype AA is not associated with response to sunitinib in people with Carcinoma, Renal Cell as compared to genotypes AG + GG. | G | A | OR | 0.5 |
| 240 | rs1048786 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.493 | ||
| 241 | rs6878291 | platinum | Efficacy | yes | Genotype GG is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype AA. | G | G | OR | 0.49 |
| 242 | rs776746 | sunitinib | Dosage | yes | Allele T is associated with decreased dose of sunitinib in people with Carcinoma, Renal Cell as compared to allele C. | OR | 0.49 | ||
| 243 | rs7624046 | ritodrine | Efficacy | yes | Genotype TT is associated with decreased response to ritodrine as compared to genotypes CC + CT. | HR | 0.485 | ||
| 244 | rs2053044 | ramipril | Efficacy | yes | Genotypes AA + AG is associated with increased response to ramipril in people with Hypertension as compared to genotype GG. | HR | 0.478 | ||
| 245 | rs10835210 | methadone | Dosage | no | Genotype CC is associated with increased dose of methadone in people with Heroin Dependence as compared to genotypes AA + AC. | OR | 0.467 | ||
| 246 | rs12409352 | methylphenidate | Efficacy | no | Allele A is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.465 | ||
| 247 | rs3210967 | methylphenidate | Efficacy | no | Allele C is associated with increased response to methylphenidate in people with Attention Deficit Disorder with Hyperactivity. | OR | 0.465 | ||
| 248 | rs10465180 | clozapine | Efficacy | yes | Genotype CC is associated with decreased response to clozapine in people with Schizophrenia as compared to genotypes CT + TT. | OR | 0.465 | ||
| 249 | rs4149117 | imatinib | Efficacy | yes | Genotypes GG + GT is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype TT. | OR | 0.461 | ||
| 250 | rs7311358 | imatinib | Efficacy | yes | Genotypes AA + AG is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype GG. | OR | 0.461 | ||
| 251 | rs1801394 | methotrexate | Efficacy | yes | Genotypes AG + GG is associated with increased response to methotrexate in children with Arthritis, Juvenile Rheumatoid as compared to genotype AA. | OR | 0.457 | ||
| 252 | rs1051266 | methotrexate | Efficacy | yes | Genotypes CT + TT is associated with increased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype CC. | T | OR | 0.455 | |
| 253 | rs523349 | abiraterone | Efficacy | yes | Genotype CC is associated with increased response to abiraterone in men with Prostatic Neoplasms as compared to genotypes CG + GG. | C | HR | 0.43 | |
| 254 | rs2838958 | methotrexate | Efficacy | yes | Genotype AA is associated with decreased response to methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes AG + GG. | HR | 0.427 | ||
| 255 | rs6545816 | hydroxyurea | Efficacy | no | Allele A is not associated with increased response to hydroxyurea in people with beta-Thalassemia. | A | A | OR | 0.417 |
| 256 | rs1799983 | salvianolic acid b | Efficacy | yes | Genotype GG is associated with increased response to salvianolic acid b in people with Coronary Disease as compared to genotypes GT + TT. | T | OR | 0.408 | |
| 257 | rs4938013 | clozapine | Efficacy | no | Allele C is not associated with response to clozapine in people with Schizophrenia as compared to allele A. | A | OR | 0.402 | |
| 258 | rs12610827 | olanzapine | Efficacy | yes | Allele T is associated with increased clinical benefit to olanzapine in people with Schizophrenia as compared to allele G. | OR | 0.402 | ||
| 259 | rs1800470 | rituximab | Efficacy | yes | Genotype AG is associated with increased response to rituximab in people with Arthritis, Rheumatoid as compared to genotype AA. | OR | 0.385 | ||
| 260 | rs462779 | cisplatin | Efficacy | yes | Genotypes AG + GG are associated with decreased response to cisplatin in people with Osteosarcoma as compared to genotype AA. | G | OR | 0.385 | |
| 261 | rs2233945 | etanercept | Efficacy | yes | Allele C is associated with decreased response to etanercept in people with Arthritis, Rheumatoid as compared to allele A. | A | OR | 0.37 | |
| 262 | rs7703002 | platinum | Efficacy | no | Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype CC. | OR | 0.366 | ||
| 263 | rs2853539 | methotrexate | Efficacy | yes | Genotype AA is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to allele G. | OR | 0.362 | ||
| 264 | rs3077 | peginterferon alfa-2b | Efficacy | yes | Genotype GG is associated with increased response to peginterferon alfa-2b in people with Hepatitis B, Chronic as compared to genotypes AA + AG. | OR | 0.36 | ||
| 265 | rs1731017 | valproic acid | Efficacy | no | Genotypes AA + AG is associated with increased resistance to valproic acid in people with Epilepsy as compared to genotype GG. | A | A | OR | 0.358 |
| 266 | rs11615 | cisplatin | Efficacy | yes | Allele A is associated with decreased response to cisplatin in women with Ovarian Neoplasms as compared to allele G. | A | OR | 0.348 | |
| 267 | rs3212227 | methotrexate | Other | no | Allele G is not associated with response to methotrexate in people with Psoriasis as compared to allele T. | OR | 0.347 | ||
| 268 | rs6785930 | clopidogrel | Efficacy | yes | Genotypes AA + AG is associated with increased resistance to clopidogrel as compared to genotype GG. | OR | 0.346 | ||
| 269 | rs324026 | olanzapine | Efficacy | yes | Allele C is associated with increased clinical benefit to olanzapine in people with Schizophrenia as compared to allele T. | C | C | OR | 0.345 |
| 270 | rs28386840 | methylphenidate | Efficacy | yes | Genotypes AT + TT are associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype AA. | OR | 0.341 | ||
| 271 | rs1232027 | methotrexate | Efficacy | yes | Allele A is associated with increased response to methotrexate in people with Arthritis, Psoriatic as compared to allele G. | OR | 0.334 | ||
| 272 | rs12708954 | atomoxetine | Efficacy | yes | Allele A is associated with increased response to atomoxetine in children with Attention Deficit Disorder with Hyperactivity as compared to allele C. | OR | 0.323 | ||
| 273 | rs1643650 | methotrexate | Efficacy | no | Genotypes CC + CT is associated with increased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype TT. | C | C | OR | 0.31 |
| 274 | rs833061 | ranibizumab | Efficacy | no | Allele C is not associated with response to ranibizumab in people with Macular Degeneration as compared to allele T. | OR | 0.291 | ||
| 275 | rs7079 | benazepril | Efficacy | yes | Genotype GG is associated with response to benazepril in women with Hypertension as compared to genotype TT. | OR | 0.286 | ||
| 276 | rs4646 | tamoxifen | Efficacy | yes | Genotype AA is associated with decreased response to tamoxifen in women with Breast Neoplasms and Menopause as compared to genotypes AC + CC. | A | HR | 0.277 | |
| 277 | rs6809699 | clopidogrel | Efficacy | yes | Genotypes AA + AC is associated with increased resistance to clopidogrel as compared to genotype CC. | OR | 0.272 | ||
| 278 | rs11269124 | clonidine | Efficacy | yes | Genotypes GGGGAGCTTTCCCAGAGACCC/del + del/del are associated with increased response to clonidine in people with Liver Cirrhosis as compared to genotype GGGGAGCTTTCCCAGAGACCC/GGGGAGCTTTCCCAGAGACCC. | OR | 0.258 | ||
| 279 | rs12539 | cannabidiol | Efficacy | yes | Genotypes CT + TT are associated with increased response to cannabidiol in people with Epilepsy as compared to genotype CC. | OR | 0.253 | ||
| 280 | rs10248420 | clozapine | Efficacy | yes | Allele A is associated with decreased response to clozapine in people with Schizophrenia as compared to allele G. | A | OR | 0.244 | |
| 281 | rs25487 | fluorouracil | Efficacy | yes | Genotype CC is associated with increased response to fluorouracil in people with Rectal Neoplasms as compared to genotype CT. | OR | 0.239 | ||
| 282 | rs10124893 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.239 | ||
| 283 | rs3784864 | methotrexate | Efficacy | yes | Genotypes AG + GG are associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotype AA. | OR | 0.236 | ||
| 284 | rs2070762 | methylphenidate | Efficacy | yes | Genotype GG is associated with decreased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes AA + AG. | OR | 0.231 | ||
| 285 | rs12083537 | tocilizumab | Efficacy | yes | Genotype AA is associated with increased response to tocilizumab in people with Arthritis, Rheumatoid as compared to genotypes AG + GG. | G | OR | 0.23 | |
| 286 | rs12502866 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.229 | ||
| 287 | rs3811381 | eculizumab | Efficacy | no | Genotypes CG + GG is not associated with response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype CC. | C | OR | 0.227 | |
| 288 | rs10123866 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 289 | rs7472 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 290 | rs7035619 | duloxetine | Efficacy | yes | Allele A is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.227 | ||
| 291 | rs6479008 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.227 | ||
| 292 | rs10989064 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.227 | ||
| 293 | rs9873889 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.216 | ||
| 294 | rs9879065 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.216 | ||
| 295 | rs3213422 | leflunomide | Efficacy | yes | Genotype CC is associated with increased clinical benefit to leflunomide in people with Arthritis, Rheumatoid as compared to genotypes AA + AC. | A | OR | 0.212 | |
| 296 | rs1799732 | bupropion | Efficacy | yes | Genotype GG is associated with increased response to bupropion in people with Tobacco Use Disorder as compared to genotypes G/del + del/del. | OR | 0.2 | ||
| 297 | rs2853542 | methotrexate | Efficacy | yes | Genotype GG is associated with decreased response to methotrexate in people with Arthritis, Rheumatoid as compared to genotypes CC + CG. | G | G | OR | 0.185 |
| 298 | rs1427407 | hydroxyurea | Efficacy | yes | Allele T is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele G. | T | T | OR | 0.164 |
| 299 | rs150929 | imatinib | Efficacy | yes | Genotypes GG + GT is associated with decreased response to imatinib in people with Leukemia, Myelogenous, Chronic, BCR-ABL Positive as compared to genotype TT. | OR | 0.157 | ||
| 300 | rs2276302 | clozapine | Efficacy | yes | Allele G is associated with increased response to clozapine in people with Schizophrenia as compared to allele A. | G | OR | 0.152 | |
| 301 | rs9332238 | warfarin | Dosage | yes | Allele G is associated with increased dose of warfarin as compared to allele A. | OR | 0.147 | ||
| 302 | rs2274567 | eculizumab | Efficacy | yes | Genotypes AG + GG is associated with decreased response to eculizumab in people with paroxysmal nocturnal hemoglobinuria as compared to genotype AA. | A | OR | 0.138 | |
| 303 | rs9310657 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.115 | ||
| 304 | rs9310658 | duloxetine | Efficacy | yes | Allele C is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.115 | ||
| 305 | rs7616119 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.115 | ||
| 306 | rs7653345 | duloxetine | Efficacy | yes | Allele A is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele G. | OR | 0.115 | ||
| 307 | rs9819548 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.115 | ||
| 308 | rs13093500 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele A. | OR | 0.115 | ||
| 309 | rs9824595 | duloxetine | Efficacy | yes | Allele G is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele T. | OR | 0.115 | ||
| 310 | rs4334661 | duloxetine | Efficacy | yes | Allele T is associated with increased response to duloxetine in people with Depressive Disorder, Major as compared to allele C. | OR | 0.115 | ||
| 311 | rs766432 | hydroxyurea | Efficacy | yes | Allele C is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele A. | C | C | OR | 0.11 |
| 312 | rs10210302 | adalimumab | Efficacy | yes | Genotypes CT + TT is associated with increased response to adalimumab in people with Crohn Disease as compared to genotype CC. | C | OR | 0.106 | |
| 313 | rs144854329 | cetuximab | Efficacy | yes | Genotype del/del is associated with increased response to cetuximab in people with Colorectal Neoplasms as compared to genotypes GGTCCCACTCTTCCCACA/GGTCCCACTCTTCCCACA + GGTCCCACTCTTCCCACA/del. | GGTCCCACTCTTCCCACA | GGTCCCACTCTTCCCACA | OR | 0.1 |
| 314 | rs1799724 | etanercept | Efficacy | yes | Genotypes CT + TT is associated with increased response to etanercept in people with Arthritis, Rheumatoid as compared to genotype CC. | OR | 0.083 | ||
| 315 | rs5882 | rosuvastatin | Efficacy | yes | Allele G is associated with increased response to rosuvastatin as compared to allele A. | G | OR | 0.075 | |
| 316 | rs2284411 | methylphenidate | Efficacy | yes | Genotype CC is associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotypes CT + TT. | C | OR | 0.07 | |
| 317 | rs9934438 | warfarin | Dosage | yes | Genotype AG is associated with increased dose of warfarin in people with Atrial Fibrillation, Cardiomyopathies, heart valve replacement, Peripheral Vascular Diseases, Pulmonary Embolism and Venous Thrombosis as compared to genotype GG. | A | OR | 0.06 | |
| 318 | rs6311 | ustekinumab | Efficacy | yes | Genotypes CT + TT is associated with decreased response to ustekinumab in people with Psoriasis as compared to genotype CC. | OR | 0.05 | ||
| 319 | rs1570360 | sildenafil | Efficacy | yes | Genotype AA is associated with decreased response to sildenafil in men with Erectile Dysfunction as compared to genotypes AG + GG. | A | A | OR | 0.05 |
| 320 | rs1967554 | methadone | Efficacy | yes | Allele C is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele A. | OR | 0.049 | ||
| 321 | rs988748 | methadone | Efficacy | yes | Allele C is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele G. | OR | 0.049 | ||
| 322 | rs2030324 | methadone | Efficacy | yes | Allele G is associated with decreased response to methadone in people with Opioid-Related Disorders as compared to allele A. | OR | 0.049 | ||
| 323 | rs749671 | warfarin | Dosage | yes | Allele G is associated with increased dose of warfarin as compared to allele A. | OR | 0.049 | ||
| 324 | rs4671393 | hydroxyurea | Efficacy | yes | Allele A is associated with increased response to hydroxyurea in people with beta-Thalassemia as compared to allele G. | A | A | OR | 0.047 |
| 325 | rs396991 | rituximab | Efficacy | yes | Genotype AA is associated with decreased response to rituximab in people with Neuromyelitis Optica as compared to genotype CC. | A | OR | 0.04 | |
| 326 | rs191190 | ustekinumab | Efficacy | yes | Genotypes CC + CT is associated with decreased response to ustekinumab in people with Psoriasis as compared to genotype TT. | OR | 0.035 | ||
| 327 | rs1062613 | clozapine | Efficacy | yes | Allele T is associated with increased response to clozapine in people with Schizophrenia as compared to allele C. | T | OR | 0.035 |
It is not enough to have "centenarian" genes to become one: You have to cut down Your health risks before. This section contains information about the risk of developing chronic age-related diseases: cardiovascular, cancer, mental health, chronic inflammation, bone and muscle diseases, and lung diseases.
Hereditary Cancers are caused by a genetic defect that determines a higher-than-normal risk of developing cancer. Hereditary cancers can have an impact on longevity, as individuals with certain genetic mutations that increase the risk of cancer may have a shorter life expectancy. The report includes about 300 genes, related to cancer predisposition, progression and tumor cell motility.
| # | Chrom | Position | Gene | RSID | cDNA Change | Zygosity | Allele Frequency | Phenotype Name | Significance | |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | chr9 | 95174077 | FANCC | rs7850958 | c.346-1930T>C | hom | 0.461417977241 | not provided | Uncertain significance | |
| 2 | chr8 | 11758901 | GATA4 | rs1062219 | c.*426C>T | hom | 0.320965164589 | not provided | Uncertain significance | |
| 3 | chr6 | 152121769 | ESR1 | rs71660056 | c.851-3487del | het | 0.453276658411 | Emery-Dreifuss muscular dystrophy|Cerebellar ataxia | Uncertain significance | |
| 4 | chr6 | 151842200 | ESR1 | rs2234693 | c.453-397T>C | het | 0.472820185244 | Myocardial infarction, susceptibility to | risk factor | |
| 5 | chr4 | 54296368 | PDGFRA | rs34529347 | c.*1109_*1111del | het | 0.233246463142 | Idiopathic hypereosinophilic syndrome|Gastrointestinal stromal tumor | Uncertain significance | |
| 6 | chr3 | 12583766 | RAF1 | rs371820097 | c.*745_*748dup | het | 0.0100082871167 | Noonan syndrome|Noonan syndrome with multiple lentigines | Uncertain significance | |
| 7 | chr3 | 10152482 | VHL | rs71052299 | c.*2540_*2545del | hom | 0.283872598584 | Von Hippel-Lindau syndrome | Uncertain significance | |
| 8 | chr22 | 41179881 | EP300 | rs59721178 | c.*966_*967del | het | 0.0836860330896 | Rubinstein-Taybi syndrome due to CREBBP mutations | Uncertain significance | |
| 9 | chr22 | 29628628 | NF2 | rs5844863 | c.115-8101del | het | None | Neurofibromatosis, type 2 | Uncertain significance | |
| 10 | chr18 | 51084013 | SMAD4 | rs1555688055 | c.*5546_*5547insGCAC | het | 0.0558176100629 | Juvenile Polyposis|Myhre syndrome|Telangiectasia, hereditary hemorrhagic, type 1 | Uncertain significance | |
| 11 | chr17 | 42314852 | STAT3 | rs754306251 | c.*893dup | het | 0.0704885343968 | Hyper-IgE syndrome | Uncertain significance | |
| 12 | chr17 | 7668837 | TP53 | rs200757381 | c.*772del | hom | 0.631307090039 | Li-Fraumeni syndrome | Uncertain significance | |
| 13 | chr15 | 98963214 | IGF1R | rs35151840 | c.*5789del | hom | 0.636829615567 | Growth delay due to insulin-like growth factor I resistance | Uncertain significance | |
| 14 | chr15 | 38352242 | SPRED1 | rs147547509 | c.*590_*595dup | het | 0.0101997146933 | Legius syndrome | Uncertain significance | |
| 15 | chr14 | 95090172 | DICER1 | rs35649919 | c.*326del | hom | 0.676011739265 | Pleuropulmonary blastoma | Uncertain significance | |
| 16 | chr11 | 22623348 | FANCF | rs45554234 | c.*1338dup | hom | 0.959894071852 | Fanconi anemia | Uncertain significance | |
| 17 | chr10 | 87966903 | PTEN | rs5786797 | c.*1458_*1459del | het | 0.231438812084 | PTEN hamartoma tumor syndrome | Uncertain significance | |
| 18 | chr10 | 8054744 | GATA3 | rs60098638 | c.-503_-502dup | het | 0.32433898974 | Hypoparathyroidism, deafness, renal disease syndrome | Uncertain significance | |
| 19 | chr1 | 158611132 | SPTA1 | rs55832242 | c.*131_*132del | het | 0.319211377831 | Elliptocytosis|Pyropoikilocytosis, hereditary|Spherocytosis, Recessive | Uncertain significance | |
| 20 | chr1 | 26766242 | ARID1A | rs781401097 | c.2754G>C | het | 3.58362997826e-05 | not provided | Uncertain significance |
Beneficial Genotypes:
Currently, the provided report does not list any genotypes that are explicitly beneficial. All listed genotypes are of uncertain significance or associated with potential health risks.
Detrimental Genotypes:
There are no specific interactions between the listed genotypes provided in the report. However, it is important to consider that multiple mutations in tumor suppressor genes (e.g., PTEN, TP53) could potentially amplify cancer risks.
Longevity Related Risks:
General Risks:
All listed genotypes are of uncertain significance, meaning that their exact impact on health is not fully understood. Continuous monitoring of scientific research and regular consultations with healthcare professionals are recommended to stay updated on any new findings related to these genotypes.
Coronary artery disease (CAD) is a condition in which the blood vessels that supply the heart muscle with oxygen and nutrients become narrowed or blocked, leading to reduced blood flow to the heart. Age is a major risk factor for CAD, as the risk of developing CAD increases with age. Genetic factors plays an important role in the development of coronary artery disease (CAD).
However, it's important to note that genetics is just one of many factors that contribute to the development of CAD, and having a genetic predisposition to the disease does not necessarily mean that an individual will develop it.
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs8055236 | CDH13 | G | G/G | PMID 17554300; PMID 19956433; PMID 20017983; | European | [PMID 17554300]: 6 x 10-6 | -1.7 | |
| 2 | rs501120 | LINC02881 | A | A/A | PMID 17634449; PMID 23202125; PMID 22042884; PMID 21804106; PMID 20847302; PMID 20098575; PMID 19750184; PMID 19955471; PMID 19164808; | European | [PMID 17634449]: 9 x 10-8 | -1.4 | |
| 3 | rs4977574 | CDKN2B-AS1 | G | G/A | PMID 17478681; PMID 21378990; PMID 21378988; PMID 24916648; PMID: 30278588 | European; Asian | [PMID 29263402]: 1 x 10-7; [PMID 21239051]: 1 x 10-14; | -1.3 | |
| 4 | rs17465637 | MIA3 | C | C/C | PMID: 35768776; PMID 19956433; PMID 21804106; PMID 21984477; PMID 21264445; | European; Iranian; | [PMID 17634449]: 1 x 10-6; [PMID 21378990]: 1 x 10-8; | -1.2 | |
| 5 | rs17228212 | SMAD3 | C | C/T | PMID 17634449; PMID 19750184; PMID 19956433; PMID 20017983; PMID 21804106; | European | [PMID 17634449]: 2 x 10-7 | -1.1 | |
| 6 | rs1122608 | LDLR | G | G/G | PMID: 27664493; PMID 23380588; PMID 23202125; PMID 20810930; PMID 19956433; PMID: 33321069; PMID 21378990; | European; Asian | [PMID: 33321069]: 5 x 10-7; [PMID 21378990]: 1 x 10-9 | -1.0 | |
| 7 | rs383830 | APC | A | A/A | PMID 26436499; PMID 17554300; PMID 21804106; PMID 19956433; PMID 21804106; | European | -0.9 | ||
| 8 | rs1746048 | CXCL12 (LINC02881) | C | C/C | PMID: 28614256; PMID 19956433; PMID 23531450; PMID 21378990; PMID 33632238; PMID 21378990; | European; Asian | [PMID 33632238]: 1 x 10-6; [PMID 21378990]:3 x 10-10; | -0.9 | |
| 9 | rs7250581 | G | G/G | PMID 19955471; PMID 19956433; PMID 17554300; | European | -0.8 | |||
| 10 | rs12413409 | CNNM2 | G | G/G | PMID 21378988; PMID 24262325; PMID: 21378990; PMID: 31228190; PMID 21378990; | European | [PMID 21378990]: 1 x 10-9 | -0.8 | |
| 11 | rs6725887 | WDR12 | C | C/C | PMID 19956433; PMID 26629484; PMID 28710368; PMID 21378990; PMID 24262325; PMID 17634449; PMID 21378990; | European | [PMID 17634449]: 6 x 10-8; [PMID 21378990]: 1 x 10-9; | -0.8 | |
| 12 | rs688034 | SEZ6L | T | T/T | PMID 17554300; PMID 19956433; PMID 20017983; | European | [PMID 17554300]: 4 x 10-6 | -0.7 | |
| 13 | rs11206510 | PCSK9 | T | C/T | PMID 20864672; PMID 21378990; | Multiethnic; Asian | [PMID 26343387]: 2 x 10-8; [PMID 32469254]: 1 x 10-8; | -0.6 | |
| 14 | rs7692387 | GUCYA3 | G | G/G | PMID: 31228190; PMID 23202125; PMID 31883534; | European; Chinese | [PMID: 29212778]: Discovery sample description: up to 122,733 cases, up to 424,528 controls | -0.5 | |
| 15 | rs55730499 | LPA | T | T/T | PMID: 26343387 | Multiethnic; | [PMID 26343387]: 5 x 10-39 | -0.4 | |
| 16 | rs181100621 | PKN2-AS1 | A | A/A | PMID 33632238; | Asian | [PMID 33632238]: 1 x 10-5; | -0.3 | |
| 17 | rs3184504 | SH2B3 | T | C/T | PMID 24262325; PMID 21378990; PMID 26343387; | Multiethnic | -0.1 | ||
| 18 | rs964184 | ZPR1 | G | C/C | PMID 19060906; PMID 20864672; PMID 21378990; PMID 22003152; PMID 21378990; PMID 28714975; | European | [PMID 28714975]: 5 x 10-6; [PMID 21378990]: 1 x 10-17; | 0.0 | |
| 19 | rs515135 | APOB | T | C/C | PMID 23202125; PMID: 30507093; PMID 29212778; | European | [PMID 29212778]: 6 x 10-17 | 0.0 | |
| 20 | rs2943634 | C | C/A | PMID 17634449; PMID 23659870; PMID 22042884; PMID 19956433; PMID 19750184; PMID 22207032; | European | [PMID 17634449]: 2 x 10-7 | 0.0 | ||
| 21 | rs17514846 | FURIN | A | A/A | PMID: 26343387; PMID 23202125; PMID: 32067586; | Multiethnic | [PMID: 26343387]: 3 x 10-7; | 0.0 | |
| 22 | rs17672135 | FMN2 | C | C/C | PMID 19956433; PMID 17554300; PMID 20017983; | European | [PMID 17554300]: 2 x 10-6 | 0.2 | |
| 23 | rs11591147 | PCSK9 | T/G | PMID 30104761; PMID 28714975; PMID 23083789; PMID 18193044; | European; | [PMID 30104761]: 2 x 10-12; [PMID 28714975]: 3 x 10-10 | 0.7 | ||
| 24 | rs6922269 | MTHFD1L | A | A/G | PMID 17634449; PMID 17554300; PMID 19164808; PMID 22216278; PMID 17634449; | European | [PMID 17634449]: 3 x 10-8; | 0.7 | |
| 25 | rs1333049 | CDKN2B-AS1 | C | C/G | PMID 17634449, PMID 18362232; PMID 20031606; PMID 19171343; PMID 18979498; PMID 24573017; PMID 23202125; PMID 22623978; PMID 17554300; PMID 33321069; | European; Multiethnic; | [PMID 17554300]: 1 x 10-13; [PMID 33321069]: 5 x 10-18; | 0.9 | |
| 26 | rs3798220 | LPA | C | C/C | PMID: 21378990; PMID 18775538; PMID 20032323; | European | [PMID 21378990]: 3 x 10-11 | 1.5 |
Beneficial Genotypes:
rs11591147 (PCSK9): The TG genotype is protective and is associated with reduced risk of heart disease. This genotype is linked to lower LDL cholesterol levels and a reduced risk of cardiovascular events. More info
rs17465637 (MIA3): The CC genotype increases susceptibility to coronary artery disease and myocardial infarction, with a 1.3x elevated risk. More info
rs964184 (ZPR1): The CC genotype is not associated with an increased risk of hypertriglyceridemia and coronary artery disease. More info
rs515135 (APOB): The CC genotype does not contain the risk indicating typical risk for coronary heart disease. More info
rs2943634: The C/A SNP is not associated with an increased risk of coronary artery disease. More info
rs17514846 (FURIN): The CC genotype is not associated with an increased risk of coronary artery disease. More info
rs3798220 (LPA): The C allele is associated with higher levels of plasma Lp(a) and a higher risk of major cardiovascular events, including coronary artery disease. Low-dose aspirin therapy in women can reduce the negative impact of the allele. More info
rs1333049 (CDKN2B-AS1): The GC genotype is associated with a 1.5x increased risk for coronary artery disease. More info
rs17672135 (FMN2): The CC genotype is associated with a slightly reduced risk of heart disease. More info
Detrimental Genotypes:
rs11206510 (PCSK9): The TC variant carriers may have an elevated risk of coronary artery disease due to PCSK9 overexpression, which increases plasma LDL-C levels. More info
rs3184504 (SH2B3): The TC variant is associated with a slightly increased risk of coronary artery disease. More info
rs17228212 (SMAD3): The CT genotype carriers have a 1.26x increased risk for heart disease. More info
rs7250581: The GG genotype is associated with a 1.40x increased risk of coronary artery disease. More info
rs4977574 (CDKN2B-AS1): The GA carriers have a 1.3x increased susceptibility to coronary artery disease. More info
rs1122608 (LDLR): The GG genotype is associated with an increased risk for coronary artery disease. More info
rs12413409 (CNNM2): The GG genotype is associated with an increased risk of coronary disease. More info
rs7692387 (GUCYA3): The GG genotype is associated with an increased risk of heart disease. More info
rs1746048 (CXCL12): The CC carriers have a 1.1-1.3x increased risk for coronary heart disease. More info
rs6725887 (WDR12): The CC carriers have a shared genetic susceptibility to ischemic stroke and coronary artery disease. More info
rs8055236 (CDH13): The GG genotype is associated with an increased risk for heart disease, with an odds ratio of 2.23. More info
rs688034 (SEZ6L): The TT genotype is associated with a 1.6x increased risk of heart disease. More info
rs501120 (LINC02881): The AA genotype is associated with a more than 1.3x increased risk for heart disease. More info
rs181100621 (PKN2-AS1): The AA genotype is associated with an increased risk of coronary artery disease. More info
The presence of multiple detrimental genotypes, such as rs11206510 (PCSK9), rs3184504 (SH2B3), and rs1122608 (LDLR), may amplify the risk of coronary artery disease. Conversely, beneficial genotypes like rs11591147 (PCSK9) and rs3798220 (LPA) may mitigate some of these risks.
Longevity Related Risks:
The presence of detrimental genotypes such as rs11206510 (PCSK9), rs3184504 (SH2B3), and rs1122608 (LDLR) increases the risk of coronary artery disease, which can impact overall longevity.
General Risks:
Genotypes like rs17465637 (MIA3) and rs4977574 (CDKN2B-AS1) are associated with an increased risk of myocardial infarction and coronary artery disease, which are significant health risks.
Lifestyle Changes: Regular physical activity, maintaining a healthy weight, and avoiding smoking can help reduce the risk of coronary artery disease.
Dietary Adjustments: A diet low in saturated fats, trans fats, and cholesterol, and rich in fruits, vegetables, and whole grains can help manage cholesterol levels and reduce heart disease risk.
Medical Interventions: For individuals with high-risk genotypes like rs3798220 (LPA) and rs7692387 (GUCYA3), low-dose aspirin therapy may be beneficial. Regular monitoring of cholesterol levels and other cardiovascular risk factors is also recommended.
The presence of beneficial genotypes such as rs11591147 (PCSK9) and rs3798220 (LPA) indicates a reduced risk of heart disease, which is a positive aspect of the individual's genetic profile. However, it is essential to consider the overall genetic risk and take proactive measures to mitigate potential health risks.
Timely detection and diagnosis of heart disorders can lead to enhanced treatment options, help to prevent sudden cardiac death, and improve prognosis. This report analyzes the most relevant genes for arrhythmias, congenital heart disease, and cardiomyopathies. Analyzed gene abnormalities may cause the following syndromes: Long and short QT, Brugada syndrome, catecholaminergic polymorphic ventricular tachycardia, cardiomyopathies dilated and hypertrophic, and congenital heart defects. In addition, this panel includes vascular abnormalities, such as dolichoectasia and hereditary hemorrhagic telangiectasia.
| # | Gene | rsID | cDNA change | Your genotype | Sequence ontology | SIFT prediction | Allele Frequency | Significance | ClinVar ID | OMIM | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | DMD | rs1801187 | c.5234G>A | T/T | MIS | Damaging | 0.513357050928 | Benign | 94657 | 302045; 310200 | |
| 2 | FKTN | rs34787999 | c.608G>A | A/A | MIS | Damaging | 0.249202580096 | Benign/Likely benign | 93522 | 253800; 611588; 611615; 613152 | |
| 3 | KCNH2 | rs958442820 | c.2735G>A | T/C | MIS | Tolerated | 5.26315789474e-05 | Uncertain significance | 527012 | 527012 | |
| 4 | PKD1L1 | rs2686817 | c.934G>T | A/C | MIS | Damaging | 0.493475262581 | Benign | 1237805 | 1237805 | |
| 5 | NME8 | rs56128139 | c.1478T>C | C/T | MIS | Damaging | 0.271294673582 | Benign | 178811 | 178811 | |
| 6 | NME8 | rs62001869 | c.1007G>A | A/G | MIS | Damaging | 0.0157295398914 | Benign | 226853 | 610852 | |
| 7 | NME8 | rs10250905 | c.622T>C | C/T | MIS | Damaging | 0.736013477567 | Benign | 164801 | 164801 | |
| 8 | DNAH11 | rs2003417 | c.7756T>C | C/T | MIS | Damaging | 0.0372413741442 | Benign/Likely benign | 163111 | 163111 | |
| 9 | DNAAF5 | rs4720951 | c.1895T>C | C/T | MIS | Damaging | 0.433830778724 | Benign | 260930 | 260930 | |
| 10 | DNAAF5 | rs6946758 | c.1784-1298C>G | G/C | INT | Damaging | 0.427423699075 | Benign | 1185315 | 1185315 | |
| 11 | SYNE1 | rs4407724 | c.10191C>A | T/T | SYN | Damaging | 0.658192709733 | Benign | 130388 | 130388 | |
| 12 | SYNE1 | rs4645434 | c.12180G>T | A/A | MIS | Damaging | 0.580499724183 | Benign | 130397 | 610743; 612998 | |
| 13 | ANK2 | rs36210417 | c.9854T>C | C/T | MIS | Damaging | 0.00863359900073 | Benign/Likely benign | 190528 | 600919 | |
| 14 | MYLK | rs9840993 | c.439C>T | A/A | MIS | Damaging | 0.94149056791 | Benign | 198606 | 613780 | |
| 15 | RAF1 | rs759107333 | c.1420A>G | C/T | MIS | Damaging | 7.95772854596e-06 | None | None | None | |
| 16 | TBX1 | rs4819522 | c.1049C>T | T/T | MIS | Damaging | 0.207468145769 | Benign | 403525 | 403525 | |
| 17 | GATA5 | rs113068438 | c.8A>G | C/T | MIS | Damaging | 0.00586321781789 | Benign/Likely benign | 180366 | 180366 | |
| 18 | TTN | rs10497520 | c.3601A>G | C/C | MIS | Damaging | 0.688710066049 | Benign | 46973 | 600334; 604145; 608807; 611705; 603689 | |
| 19 | TTN | rs2291311 | c.9781G>A | T/T | MIS | Damaging | 0.844463342901 | Benign | 47692 | 600334; 604145; 608807; 611705; 603689 | |
| 20 | DNAAF3 | rs2365725 | c.875A>G | C/T | MIS | Damaging | 0.171971791255 | Benign/Likely benign | 257676 | 606763 | |
| 21 | RYR1 | rs2071089 | c.9186A>G | G/A | SYN | Damaging | 0.322394110213 | Benign | 93306 | 93306 | |
| 22 | NOTCH3 | rs11670799 | c.1487C>T | A/G | MIS | Damaging | 0.011983974782 | Benign/Likely benign | 256120 | 125310 | |
| 23 | NOTCH3 | rs4809029 | c.5913+28T>G | C/C | INT | Damaging | 0.868945990553 | Benign | 811011 | 811011 | |
| 24 | DTNA | rs9944927 | c.*2593G>A | A/G | UT3 | Damaging | 0.219157079015 | Benign | 137181 | 137181 | |
| 25 | CCDC40 | rs7207166 | c.2832+381G>A | A/A | INT | Damaging | 0.711252785343 | Benign | 1283901 | 1283901 | |
| 26 | COL1A1 | rs781614679 | c.3754C>T | A/G | MIS | Damaging | 1.19636305631e-05 | Conflicting classifications of pathogenicity | 1037654 | 1037654 | |
| 27 | JUP | rs41283425 | c.425G>A | T/C | MIS | Damaging | 0.0438894050371 | Benign/Likely benign | 45851 | 601214; 611528 | |
| 28 | GAS8 | rs17178299 | c.776G>A | A/G | MIS | Damaging | 0.0526985397651 | Benign | 402892 | 402892 | |
| 29 | MYH11 | rs113964173 | c.5676G>C | G/C | MIS | Damaging | 0.00501641478463 | Benign/Likely benign | 138358 | 132900 | |
| 30 | ALPK3 | rs187316 | c.4259T>C | C/T | MIS | Damaging | 0.226143503793 | Benign/Likely benign | 384691 | 384691 | |
| 31 | DNAAF4 | rs600753 | c.572A>G | C/T | MIS | Damaging | 0.554209658117 | Benign | 262315 | 262315 | |
| 32 | SYNE2 | rs142660236 | c.15794T>C | C/T | MIS | Damaging | 0.0137591284823 | Benign | 130481 | 612999 | |
| 33 | SYNE2 | rs8010699 | c.9926A>G | G/G | MIS | Damaging | 0.804419189222 | Benign | 130521 | 612999 | |
| 34 | SYNE2 | rs8010911 | c.9757G>C | C/C | MIS | Damaging | 0.803822390229 | Benign | 130520 | 612999 | |
| 35 | SYNE2 | rs4027402 | c.6851C>T | T/T | MIS | Damaging | 0.809269092335 | Benign | 130504 | 612999 | |
| 36 | SYNE2 | rs4902264 | c.5906T>C | C/T | MIS | Damaging | 0.807647922039 | Benign | 130501 | 612999 | |
| 37 | SOS2 | rs3736760 | c.2057+38C>T | A/G | INT | Damaging | 0.762008389107 | Benign | 1266724 | 1266724 | |
| 38 | DNAAF2 | rs2985684 | c.186G>C | G/G | MIS | Damaging | 0.64203724391 | Benign | 95893 | 612518 | |
| 39 | MMP3 | rs679620 | c.133A>G | C/T | MIS | Damaging | 0.578682343782 | Benign | 403098 | 403098 | |
| 40 | MYBPC3 | rs3729986 | c.472G>A | T/C | MIS | Damaging | 0.0662396894711 | Benign | 42758 | 615396; 115197 | |
| 41 | BAG3 | rs2234962 | c.451T>C | C/T | MIS | Damaging | 0.170283253861 | Benign/Likely benign | 44783 | 612954; 613881 | |
| 42 | MYPN | rs7079481 | c.3403C>A | A/A | MIS | Damaging | 0.430328419891 | Benign/Likely benign | 31800 | 615248 | |
| 43 | CACNB2 | rs58225473 | c.1965T>G | G/T | MIS | Damaging | 0.137294962562 | Benign | 136649 | 611876 | |
| 44 | CPT2 | rs1799822 | c.1939A>G | G/A | MIS | Damaging | 0.162231592375 | Benign | 92433 | 600649; 608836 | |
| 45 | SELENON | rs2294228 | c.1506C>A | A/A | MIS | Damaging | 0.771142168881 | Benign | 95959 | 602771 |
Beneficial Genotypes:
None of the genotypes provided in the report are classified as beneficial.
Detrimental Genotypes:
Several genotypes related to cardiovascular conditions (e.g., MYPN, BAG3, MYBPC3, JUP, TTN) may interact and potentially amplify the risk of developing cardiomyopathies. Additionally, multiple genotypes associated with primary ciliary dyskinesia (e.g., DNAAF2, DNAAF4, DNAAF3, DNAAF5, DNAH11, NME8) could collectively increase the severity of ciliary dysfunction.
Longevity Related Risks:
General Risks:
It is important to note that while these genotypes indicate a predisposition to certain conditions, they do not guarantee the development of these conditions. Environmental factors, lifestyle choices, and other genetic factors also play a significant role in overall health. Regular medical check-ups and a healthy lifestyle can help manage and mitigate potential risks.
Lipid metabolism plays an important role in the development of heart disease, and this risk increases with age. Cholesterol is a type of lipid that is carried in the blood by lipoproteins, including low-density lipoprotein (LDL) and high-density lipoprotein (HDL). LDL is often referred to as "bad" cholesterol, as high levels of LDL are associated with an increased risk of CAD. HDL, on the other hand, is often referred to as "good" cholesterol, as it helps to remove cholesterol from the bloodstream and may have a protective effect against CAD. As we age, our lipid metabolism tends to change. For example, LDL cholesterol levels tend to increase, while HDL cholesterol levels tend to decrease. This can increase the risk of CAD and other heart diseases.
Genetics plays an important role in lipid metabolism and the development of heart disease. Genes control the production, transport, and metabolism of cholesterol and other lipids.
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs429358 | APOE | C | CT | [PMID 20429872]; [PMID 34887591]; | European; Asian; African; | 6,00E-256 | -1.5 | |
| 2 | rs12740374 | CELSR2 | G | TT | [PMID: 25350695]; [PMID: 28577571]; | European; African; | 2,00E-26 | -0.8 | |
| 3 | rs676210 | APOB | G | AG | [PMID: 26629186]; [PMID: 34156559]; [PMID: 23247145] | European, Chinese; | 6,00E-197 | -0.5 | |
| 4 | rs708272 | CETP | G | GG | [PMID 18560005]; [PMID 20031564]; [PMID: 27608031]; [PMID: 31739638]; [PMID: 34503513]; | European; Han Chinese; Asian; Western Siberia; | 3,00E-11 | -0.5 | |
| 5 | rs6756629 | ABCG8, ABCG5 | G | GG | [PMID: 20832063]; [PMID:19060911]; | European; | 3,00E-06 | -0.5 | |
| 6 | rs328 | LPL | G | GC | [PMID: 18193044]; [PMID: 30944368]; [PMID: 19148283]; | European; African | 2,00E-28 | -0.4 | |
| 7 | rs5128 | APOC3 | G | CC | [PMID 19424489]; [PMID 17357073]; [PMID 19057464]; [PMID: 34503513]; | European; | 5,00E-14 | 0.0 | |
| 8 | rs2650000 | HNF1A-AS1 | A | CC | [PMID: 28035729]; [PMID 19060906]; | European; Chinese; | 2,00E-08 | 0.0 | |
| 9 | rs6544713 | ABCG8 | T | CC | [PMID: 30926973]; | European; African; Asian; Latin American; | 3,00E-24 | 0.0 | |
| 10 | rs268 | LPL | A | AA | [PMID 22399527]; [PMID: 20429872]; [PMID 16741292]; [PMID 16651467]; | European; | 2,00E-12 | 0.0 | |
| 11 | rs2967605 | RAB11B | C | CC | [PMID: 29507422]; | European; | 8,00E-09 | 0.0 | |
| 12 | rs471364 | TTC39B | C | TT | [PMID 21738485]; [PMID 19951432]; [PMID: 19060906]; | European; | 3,00E-10 | 0.3 | |
| 13 | rs1800961 | HNF4A | C | CC | [PMID: 24097068]; [PMID: 18660489]; | European; | 2,00E-34 | 0.4 | |
| 14 | rs7679 | PCIF1 | T | TT | [PMID: 19060906]; [PMID: 19965587]; | European; | 7,00E-11 | 0.5 | |
| 15 | rs7412 | APOE | C | TC | [PMID 20406466]; [PMID 20429872]; [PMID 22174202]; [PMID: 34887591]; [PMID: 28270201]; | European; Asian; African; | 6,00E-14 | 1.5 |
Beneficial Genotypes:
1. rs5128 (APOC3): The CC variant is favorable and associated with better lipid metabolism.
2. rs2650000 (HNF1A-AS1): The CC genotype is favorable and may play a role in lipid metabolism and energy homeostasis.
3. rs7412 (APOE): The TC genotype indicates the presence of an Apoε2 allele, which is protective against lipid elevation and neurodegeneration.
4. rs268 (LPL): The AA genotype is favorable and not associated with impaired lipid metabolism.
5. rs7679 (PCIF1): The TT genotype is favorable regarding lipid metabolism, associated with increased HDL and decreased triglyceride levels.
6. rs1800961 (HNF4A): The CC genotype is favorable and involved in the regulation of lipid metabolism.
7. rs2967605 (RAB11B): The CC variant is favorable and involved in lipid metabolism regulation.
8. rs471364 (TTC39B): The TT genotype is favorable regarding HDL levels.
Detrimental Genotypes:
1. rs12740374 (CELSR2): The TT genotype is associated with an increased risk of LDL elevation but a better response to statins.
2. rs429358 (APOE): The CT genotype is part of the APOE-ε4 allele, associated with an increased risk of Alzheimer's disease and impaired lipid metabolism.
3. rs676210 (APOB): The AG genotype is associated with an elevated risk of hyperlipidemia.
4. rs328 (LPL): The GC genotype slightly increases the risk of high triglycerides and coronary artery disease.
5. rs708272 (CETP): The GG genotype is associated with an increased risk of lipid profile disturbance but responds well to statin therapy.
6. rs6756629 (ABCG8, ABCG5): The GG genotype is associated with an increased risk of elevated LDL and triglycerides.
The presence of the APOE-ε4 allele (rs429358) combined with the unfavorable rs676210 (APOB) genotype may amplify the risk of lipid metabolism disorders and cardiovascular diseases. However, the favorable response to statin therapy in individuals with the rs12740374 (CELSR2) and rs708272 (CETP) genotypes may mitigate some of these risks.
Longevity Related Risks:
1. rs429358 (APOE): Increased risk of Alzheimer's disease and cognitive decline.
2. rs328 (LPL): Increased risk of coronary artery disease.
General Risks:
1. rs12740374 (CELSR2): Increased risk of LDL elevation.
2. rs676210 (APOB): Increased risk of hyperlipidemia.
3. rs6756629 (ABCG8, ABCG5): Increased risk of elevated LDL and triglycerides.
1. Lifestyle Changes: Regular exercise, maintaining a healthy weight, and reducing stress can help mitigate the risks associated with the APOE-ε4 allele and other detrimental genotypes.
2. Dietary Adjustments: A diet low in saturated fats and high in phytonutrient-rich foods can help manage lipid levels. For carriers of the APOE-ε4 allele, focusing on the quality and quantity of dietary fat is crucial.
3. Medical Interventions: Statin therapy can be particularly effective for individuals with the rs12740374 (CELSR2) and rs708272 (CETP) genotypes. Regular monitoring of lipid levels and cardiovascular health is recommended.
While the presence of certain genotypes can increase the risk of specific health conditions, it is important to remember that genetics is only one factor. Environmental factors, lifestyle choices, and other genetic variants also play significant roles in determining overall health. Regular check-ups and personalized medical advice are essential for managing health risks effectively.
Thrombophilia is a condition in which an individual has an increased tendency to develop blood clots. This can be caused by genetic or acquired factors, and the risk of developing thrombophilia increases with age. Thrombophilia risk has a strong genetic component, as certain genetic mutations can increase the risk of developing blood clots. The most common genetic mutations associated with thrombophilia are mutations in the genes that control the production and function of clotting factors.
However, it's important to note that having a genetic mutation does not necessarily mean that an individual will develop thrombophilia. Other factors, such as lifestyle factors and medical conditions, can also contribute to the development of thrombophilia.
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs1801133 | MTHFR | A | AG | [PMID: 30466296]; [PMID: 34707639]; | European; East Asians; West Asians; | [PMID: 20031578]: 8 x 10-35; [PMID: 34707639]: 4 x 10-104; | -1.3 | |
| 2 | rs1799889 | SERPINE | A | AA | [PMID 9700201]; [PMID 16424345]; [PMID: 23180602]; [PMID: 31948344] | None | [PMID: 31948344]: 0,05 | -1.0 | |
| 3 | rs1800790 | FGB | A | AG | [PMID 29235504]; [PMID: 31354890] | None | [PMID: 29235504]: 0.001 | -0.3 | |
| 4 | rs8176719 | ABO | C | C- | [PMID: 22672568]; [PMID 21463476]; | European | [PMID: 22672568]: 6 x 10-12 | -0.3 | |
| 5 | rs2519093 | ABO | T | CC | [PMID: 21463476]; [PMID: 33512453]; [PMID: 31420334] | European; African American; | [PMID: 31420334]: 4 x 10-169 | 0.0 | |
| 6 | rs6025 | F5 | C | CC | [PMID 28373160]; [PMID 23900608]; [PMID 14996674]; [PMID 10666427]; [PMID 10477778]; | European; African American; | [PMID: 31676865]: 1 x 10-300; | 0.0 | |
| 7 | rs1799963 | F2 | G | GG | [PMID 23900608]; [PMID 19404532];[PMID 22784820]; | European | [PMID: 26908601]:1 x 10-24 | 0.0 | |
| 8 | rs5918 | ITGB3 | T | TT | [PMID 8598867]; [PMID 9700201]; [PMID 11723016]; | None | [PMID: 9700201]: 0,01 | 0.0 | |
| 9 | rs2036914 | F11 | T | TT | [PMID: 19583818]; [PMID: 31420334]; [PMID 21232005]; [PMID 23150947]; [PMID: 25091233] | European; African Americans | [PMID 31420334]: 2 x 10-54 | 0.0 |
Beneficial Genotypes:
rs2519093 (ABO, CC): This genotype is not associated with an increased risk of venous thromboembolism (VTE). NCBI Link
rs6025 (F5, CC): This genotype is not associated with an increased risk of thrombophilia. NCBI Link
rs1799963 (F2, GG): This genotype is associated with a normal/common risk of thrombosis. NCBI Link
rs5918 (ITGB3, TT): This genotype is not associated with an increased risk of heart diseases, and aspirin is efficient as an anti-thrombotic drug. NCBI Link
rs2036914 (F11, TT): This genotype is favorable and not associated with an increased risk of deep vein thrombosis (DVT). NCBI Link
Detrimental Genotypes:
rs1801133 (MTHFR, AG): This genotype is associated with an increased risk of hyperhomocysteinemia and thrombophilia. NCBI Link
rs1800790 (FGB, AG): This genotype is associated with an increased risk of cardiovascular diseases. NCBI Link
rs8176719 (ABO, C-): This genotype is associated with an increased risk of venous thromboembolism (VTE). NCBI Link
rs1799889 (SERPINE, AA): This genotype is associated with an increased risk of blood clots, atherosclerosis, and coronary artery disease. NCBI Link
The combination of the rs1799889 (SERPINE, AA) and rs5918 (ITGB3, TT) genotypes may amplify the risk of myocardial infarction, particularly in males. The concurrent carrier status of these two genetic variants conferred a high risk for the development of myocardial infarction in a Finnish study population.
Longevity Related Risks:
rs1801133 (MTHFR, AG): Increased risk of hyperhomocysteinemia and thrombophilia, which can affect overall longevity.
rs1799889 (SERPINE, AA): Increased risk of blood clots, atherosclerosis, and coronary artery disease, which can impact longevity.
General Risks:
rs1800790 (FGB, AG): Increased risk of cardiovascular diseases.
rs8176719 (ABO, C-): Increased risk of venous thromboembolism (VTE).
For rs1801133 (MTHFR, AG): Consider increasing intake of folic acid and vitamin B12 through diet or supplements to mitigate the risk of hyperhomocysteinemia and thrombophilia.
For rs1800790 (FGB, AG): Regular cardiovascular check-ups, maintaining a healthy diet, and engaging in regular physical activity can help reduce the risk of cardiovascular diseases.
For rs1799889 (SERPINE, AA): Regular monitoring of blood clotting factors, maintaining a healthy weight, and avoiding smoking can help reduce the risk of blood clots, atherosclerosis, and coronary artery disease.
For rs8176719 (ABO, C-): Regular monitoring for signs of venous thromboembolism and maintaining an active lifestyle can help mitigate the risk.
It is important to consult with a healthcare provider or a genetic counselor to discuss these findings in detail and to develop a personalized health plan based on this genomic information. Regular health check-ups and lifestyle modifications can play a significant role in managing the risks associated with these genetic variants.
| # | RSID | Gene | Risk Allele | Genotype | Pubmed ID | Population | P-Value | Weight | |
|---|---|---|---|---|---|---|---|---|---|
| 1 | rs10921078 | RGS18 | G | GG | [PMID 21183627] | Caucasian; African-American | 7.17E-5 | -1.0 | |
| 2 | rs11715829 | ZIC4 | T | TT | [PMID 21183627] | Caucasian | 8.68E−6 | -1.0 | |
| 3 | rs6552828 | ACSL1 | A | AA | [PMID 21183627]; [PMID: 23990238] | Caucasian | 1.31E-6 | -1.0 | |
| 4 | rs1956197 | DAAM1 | C | CC | [PMID 21183627] | Caucasian | 1.43E-5 | -1.0 | |
| 5 | rs824205 | NDN | C | CT | [PMID 21183627] | Caucasian | 3.45E-5 | 0.0 | |
| 6 | rs429358 | APOE | T | CT | [PMID 24571688]; [PMID 14767871] | Chinese; Caucasian | 0.02 | 0.0 | |
| 7 | rs7412 | APOE | C | TC | [PMID 24571688]; [PMID 14767871] | Chinese; Caucasian | 0.02 | 0.0 | |
| 8 | rs4952535 | FLJ44450 | A | AG | [PMID 21183627] | Caucasian | 1.01E-4 | 0.0 | |
| 9 | rs17602729 | AMPD1 | A | GG | [PMID 21967077]; [PMID 2783984] | Caucasian | 0.04 | 0.0 | |
| 10 | rs2030398 | NLGN1 | G | GG | [PMID 21183627] | Caucasian | 1.32E-4 | 0.0 | |
| 11 | rs6090314 | BIRC7, YTHDF1 | G | GG | [PMID 21183627]; [PMID: 23990238] | Caucasian | 6.4E−5 | 0.0 | |
| 12 | rs1695 | GSTP1 | A | GG | [PMID 25435667] | Caucasian | 0.029 | 1.0 |
Beneficial Genotypes:
GSTP1 (rs1695): The GG genotype is associated with a high VO2max training response. The GSTP1 gene encodes an enzyme that detoxifies harmful substances and protects against oxidative stress. The G allele is linked to increased reactive oxygen species (ROS), which can activate beneficial cellular pathways like mitochondrial biogenesis. More info.
APOE (rs7412): The TC genotype indicates the presence of the Apoε2 allele, which is protective against some cardiovascular and neurodegenerative conditions. More info.
Detrimental Genotypes:
RGS18 (rs10921078): The GG genotype is associated with a low VO2max training response. The RGS18 gene regulates cellular signaling pathways, influencing muscle contraction, blood flow, and energy utilization. More info.
ZIC4 (rs11715829): The TT genotype is associated with a low VO2max training response. The ZIC4 gene is involved in neural development, which can indirectly affect athletic abilities. More info.
ACSL1 (rs6552828): The AA genotype is associated with a low VO2max training response. The ACSL1 gene plays a crucial role in lipid metabolism, affecting endurance and aerobic capacity. More info.
DAAM1 (rs1956197): The CC genotype is associated with a low VO2max training response. The DAAM1 gene affects cellular shape and movement. More info.
The presence of beneficial genotypes like GSTP1 (rs1695) and APOE (rs7412) may mitigate some of the negative effects of detrimental genotypes like RGS18 (rs10921078) and ACSL1 (rs6552828). For example, the high VO2max training response associated with GSTP1 could potentially offset the low VO2max response linked to RGS18.
Longevity Related Risks:
APOE (rs7412): The TC genotype is protective against cardiovascular and neurodegenerative conditions, potentially contributing to increased longevity.
General Risks:
RGS18 (rs10921078): The GG genotype is associated with a low VO2max training response, which could impact overall fitness and athletic performance.
ACSL1 (rs6552828): The AA genotype is associated with a low VO2max training response, affecting endurance and aerobic capacity.
For RGS18 and ACSL1: Engage in regular cardiovascular exercise to improve VO2max and overall fitness. Consider a diet rich in antioxidants to support cellular health and reduce oxidative stress.
For APOE: Maintain a heart-healthy diet, rich in omega-3 fatty acids, and engage in regular physical activity to support cardiovascular and brain health.
The presence of the GSTP1 GG genotype suggests a strong response to high-intensity training, which could be leveraged to optimize athletic performance. Additionally, the protective effects of the APOE TC genotype against cardiovascular and neurodegenerative conditions highlight the importance of maintaining a healthy lifestyle to maximize these genetic benefits.
Beneficial Genotypes:
Several beneficial genotypes have been identified that are associated with increased longevity and better health outcomes. For instance, the rs11591147 (PCSK9) genotype is linked to reduced risk of heart disease due to lower LDL cholesterol levels. Similarly, the rs2802292 (FOXO3) genotype is associated with increased longevity across multiple populations. Other beneficial genotypes include rs5744256 (IL18) and rs1043618 (HSPA1A), which are linked to better physical function and stress response, respectively.
Detrimental Genotypes:
Several detrimental genotypes have been identified that are associated with increased health risks. For example, the rs1801133 (MTHFR) genotype is linked to an increased risk of hyperhomocysteinemia and thrombophilia. The rs429358 (APOE) genotype is associated with a higher risk of Alzheimer's disease and decreased longevity. Other detrimental genotypes include rs4977756 (CDKN2B-AS1) and rs1800790 (FGB), which are linked to cardiovascular diseases and various cancers.
Interactions between beneficial and detrimental genotypes can influence overall health outcomes. For instance, the presence of beneficial genotypes like rs11591147 (PCSK9) and rs2802292 (FOXO3) may mitigate some of the risks posed by detrimental genotypes such as rs1801133 (MTHFR) and rs429358 (APOE). However, the exact nature of these interactions would require further study.
Longevity Related Risks:
Several genotypes are associated with increased longevity, such as rs2802292 (FOXO3) and rs11591147 (PCSK9). However, detrimental genotypes like rs429358 (APOE) and rs1801133 (MTHFR) pose significant risks to longevity due to their associations with Alzheimer's disease and cardiovascular issues.
General Risks:
Genotypes such as rs1800790 (FGB) and rs4977756 (CDKN2B-AS1) are linked to general health risks, including cardiovascular diseases and various cancers. These risks can impact overall health and quality of life.
To mitigate the risks associated with detrimental genotypes, consider the following strategies:
While the presence of certain genotypes can increase the risk of specific health conditions, it is important to remember that genetics is only one factor. Environmental factors, lifestyle choices, and other genetic variants also play significant roles in determining overall health. Regular check-ups and personalized medical advice are essential for managing health risks effectively.